Team:Bio Without Borders/Design
Design
siRNA Production/reporter cassette
We wanted to use an improved version of BBa_K2246000. This part has a BamH1 site and a HincII site, between which is the siRNA sequence. We did not like the fact that it already contained an siRNA sequence, so if you need to change to another siRNA, you have to cut the plasmid with BamH1 and HincII then purify away the other siRNA otherwise you may end up with a lot of religations resulting in the original siRNA not the one you want. So we decided to eliminate any functional DNA between the BamH1 site and the HincII site. We replaced it with a nonfunctional linker that was very short and probably would not stick to the DNA purification column if you passed the cut DNA through a PCR cleanup. That was you could do the cleanup and go straight to the ligation with very little chance of religation.
We used the linker sequence:
cacatattctttagcgcctagcaagttctctgctaggcgctaaagaatatgtg
and made it one of our parts BBa_K327005
We had the entire composite part synthesized as a gene block by IDT with BioBrick ends.
We cut the gene block with EcoR1 and Pst1 and ligated it to the pSB1C3 plasmid backbone that had been cut with EcoR1 and Pst1 and the terminal phosphates removed with Antarctic Phosphatase. All enzymes were heat-inactivated before the ligation.The ligation product was predicted to look like this:
Inserting siRNA sequences
The next step is to insert the siRNA sequences into the cassette. program form Invitrogen called BLOCK-iT to design siRNAs to knock down the production of chitin synthase and superoxide dismutase (SOD). We had the siRNA sequences, which consisted of a top strand, a hairpin loop region, and a bottom strand, as two long oligos. We annealed the oligos to create the double-stranded DNA for cloning. We designed the oligos to have a BamH1 overhang on the upstream end and a blunt end on the downstream end. This is because we are inserting them into the cassette by cutting it with BamH1 and HincII. The steps in this procedure were:
- Mix the two oligos representing the upper and lower strands.
- Heat to 100C and cool slowly to room temperature.
- Cut pSB1C3 with BBa_K3377000 with BamH1 and HincII. Heat inactivate the enzymes.
- Mix annealed oligos with cut plasmid and ligate overnight.
- Transform E. coli.
The siRNA sequences were as pictured below. Note that the top strand has a four base overhangthat matches BamH1 and the bottom strand oligo was only the nucleotides in capital letters:
Unfortunately at the time of this writing we have had no success. Even though some colonies showed blue color as if the AmilCP gene was producing dye, when we inoculated LB-chlor media with the colonies and did plasmid preps, the plasmid sizes were much too large. The expected size of the BioBricks is only about 900bp and we were getting insert sizes in the thousands of nucleotides.
Although our cloning work was done in E. coli 5alpha, we are planning to use Escherichia coli HT115 (DE3) which is RNAse minus for siRNA production. We will not handle psyllids in our lab, but we will partner with investigators who are already working with psyllids in a dedicated facility. We hope that our siRNAs will prevent the psyllids from developing naturally so they die. We have designed a trap that has a psyllid attractant, and will place new citrus leaves (the "flush") in the trap with our E. coli carrying the siRNA-producing cassettes. In this way the genetically modifies bacteria is contained in the trap and not in the environment. When the psyllids feed on the trap they will also take in the transformed bacteria and die. It will be difficult for them to leave the trap once they have entered, and this will prevent spread of the genetically modified bacteria also.