Difference between revisions of "Team:CSU CHINA/Notebook"
| Line 20: | Line 20: | ||
height: 100%; | height: 100%; | ||
padding-top: 60px; | padding-top: 60px; | ||
| + | display: none; | ||
z-index: 10; | z-index: 10; | ||
| + | overflow: auto; | ||
} | } | ||
| − | + | /* 日历 */ | |
| − | + | #sidebar thead{ | |
| + | font-size: 10px; | ||
} | } | ||
#cal-title{ | #cal-title{ | ||
| Line 30: | Line 33: | ||
text-align: center; | text-align: center; | ||
} | } | ||
| − | |||
| − | |||
#cal-body{ | #cal-body{ | ||
font-weight: bold; | font-weight: bold; | ||
| Line 38: | Line 39: | ||
cursor: pointer; | cursor: pointer; | ||
} | } | ||
| − | |||
| − | |||
/* 全局容器 */ | /* 全局容器 */ | ||
#ZB img, | #ZB img, | ||
| Line 47: | Line 46: | ||
} | } | ||
#parCont>div{ | #parCont>div{ | ||
| − | margin-top: | + | margin-top: 20px; |
| + | margin-bottom: 20px; | ||
| + | z-index: 2; | ||
} | } | ||
| − | + | #ZB, | |
| − | #ZB{ | + | #ZB p, |
| + | #ZB li, | ||
| + | #ZB h2, | ||
| + | #ZB h3, | ||
| + | #ZB h4, | ||
| + | #ZB h5{ | ||
color: #FAFAFA !important; | color: #FAFAFA !important; | ||
| + | font-weight: bold; | ||
| + | } | ||
| + | #ZB{ | ||
background-color: #303030; | background-color: #303030; | ||
| − | + | margin-top: 42px; | |
overflow: auto; | overflow: auto; | ||
} | } | ||
| Line 68: | Line 77: | ||
} | } | ||
#ZB h2{ | #ZB h2{ | ||
| − | |||
padding: 20px 0px; | padding: 20px 0px; | ||
border-bottom: 1px solid white; | border-bottom: 1px solid white; | ||
} | } | ||
#ZB h3{ | #ZB h3{ | ||
| − | |||
padding: 10px 0px; | padding: 10px 0px; | ||
font-family: Times New Roman; | font-family: Times New Roman; | ||
} | } | ||
#ZB h4{ | #ZB h4{ | ||
| − | |||
padding-top: 15px; | padding-top: 15px; | ||
font-family: Times New Roman; | font-family: Times New Roman; | ||
} | } | ||
#ZB h5{/*图标注释*/ | #ZB h5{/*图标注释*/ | ||
| − | |||
font-size: 16px; | font-size: 16px; | ||
text-align: center; | text-align: center; | ||
| Line 89: | Line 94: | ||
margin: 10px auto; | margin: 10px auto; | ||
} | } | ||
| − | |||
| − | |||
| − | |||
| − | |||
/* 首页 */ | /* 首页 */ | ||
#LabStart{ | #LabStart{ | ||
display: -webkit-flex; | display: -webkit-flex; | ||
display: flex; | display: flex; | ||
| + | right: 0px; | ||
| + | top: 60px; | ||
justify-content: center; | justify-content: center; | ||
align-items: center; | align-items: center; | ||
| + | text-align: center; | ||
| + | position: fixed; | ||
| + | height: 100%; | ||
| + | z-index: 1; | ||
} | } | ||
#LabStart h1{ | #LabStart h1{ | ||
font-family: Arial Black; | font-family: Arial Black; | ||
| − | color: | + | color:#404040; |
| − | text-shadow: 5px 5px | + | text-shadow: 5px 5px 5px #808080; |
} | } | ||
| − | + | @media screen and (max-width: 1000px) { | |
| − | /* | + | #LabStart h1{ font-size: 50px; } |
| − | # | + | } |
| − | + | /*服务器*/ | |
| − | + | #globalWrapper{ | |
| − | + | padding: 0px !important; | |
| − | + | } | |
| + | /*移动端*/ | ||
| + | #mob{ | ||
| + | right: 0px; | ||
} | } | ||
</style> | </style> | ||
| − | < | + | <!-- 移动端 --> |
| − | + | ||
| + | <button type="button" class="fixed-bottom btn btn-outline-light btn-dark rounded-circle d-md-none" id="mob">≣</button> | ||
<!-- 侧边栏 --> | <!-- 侧边栏 --> | ||
| − | <div class="col-lg-3 col-md-4 bg-dark" id="sidebar"> | + | <div class="col-lg-3 col-md-4 bg-dark d-md-inline" id="sidebar"> |
| − | + | ||
| − | + | <img class="rounded" src="https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--TimeLineS.jpg" alt="" > | |
| − | + | ||
| − | <table class="table table-sm table-inverse table- | + | <table class="table table-sm table-inverse table-full bg-light rounded my-3"> |
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr id="cal-title"> | <tr id="cal-title"> | ||
| Line 144: | Line 155: | ||
</table> | </table> | ||
| − | <div class="btn-group w-100"> | + | <div class="btn-group-vertical w-100"> |
| − | <button type="button" class="btn btn-success" id="pre">previous</button> | + | <div class="btn-group w-100"> |
| − | + | <button type="button" class="btn btn-success" id="pre">previous month</button> | |
| + | <button type="button" class="btn btn-success" id="next">next month</button> | ||
| + | </div> | ||
| + | <div class="btn-group w-100"> | ||
| + | <button type="button" class="btn btn-info" id="pred">previous day</button> | ||
| + | <button type="button" class="btn btn-info" id="nextd">next day</button> | ||
| + | </div> | ||
</div> | </div> | ||
| + | |||
| + | </div> | ||
| + | <!-- 首页 --> | ||
| + | <div class="col-lg-9 col-md-8 " id="LabStart"> | ||
| + | <h1 class="display-1">NOTEBOOK</h1> | ||
</div> | </div> | ||
| + | <script>$("#LabStart").height($(document).height()-60);</script> | ||
| + | <script>$("#globalWrapper").height($(document).height());</script> | ||
| + | |||
| + | <!-- 内容 --> | ||
<div class="col-lg-9 offset-lg-3 col-md-8 offset-md-4" id="ZB"> | <div class="col-lg-9 offset-lg-3 col-md-8 offset-md-4" id="ZB"> | ||
| − | <script>$("#ZB").height($(document).height()- | + | <script>$("#ZB").height($(document).height()-60);</script> |
| − | <div | + | <div id="parCont"> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<!-- 导航 --> | <!-- 导航 --> | ||
| − | <div class="col-md- | + | <div class="col-md-10 offset-md-1" id="navfig"> |
| − | + | <img src="https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--TimeLineS.jpg" alt=""> | |
| − | <!-- 5 --> | + | </div> |
| + | <!-- 5 7+1--> | ||
<div class="col-md-12" id="May"> | <div class="col-md-12" id="May"> | ||
<h2>May</h2> | <h2>May</h2> | ||
| Line 182: | Line 203: | ||
<div class="col-md-12" id="May16"> | <div class="col-md-12" id="May16"> | ||
| − | <h2> | + | <h2>May 16</h2> |
<p> | <p> | ||
We used the GEPIA database to test the most specific differential-expressed gene in invasive breast cancer, and found out that 11 overlaps with the previously selected 245. | We used the GEPIA database to test the most specific differential-expressed gene in invasive breast cancer, and found out that 11 overlaps with the previously selected 245. | ||
| Line 221: | Line 242: | ||
<lli>Centrifuge briefly to collect the contents at the bottom of the tubes</li> | <lli>Centrifuge briefly to collect the contents at the bottom of the tubes</li> | ||
</ol> | </ol> | ||
| − | <table class="table table-sm table-inverse table-responsive table-secondary"> | + | <div class="col-md-4 offset-md-4"> |
| + | <table class="table table-sm table-inverse table-responsive table-secondary table-full"> | ||
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr> | <tr> | ||
| Line 231: | Line 253: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td rowspan="2">Reverse transcription</td> |
<td>16℃</td> | <td>16℃</td> | ||
<td>30min</td> | <td>30min</td> | ||
| Line 240: | Line 262: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Stop reaction</td> |
<td>85℃</td> | <td>85℃</td> | ||
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Hold</td> |
<td>4℃</td> | <td>4℃</td> | ||
<td>Hold</td> | <td>Hold</td> | ||
| Line 251: | Line 273: | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| + | </div> | ||
| + | |||
<h4>2.Then we utilized these cDNA for qPCR </h4> | <h4>2.Then we utilized these cDNA for qPCR </h4> | ||
| − | <table class="table table-sm table-responsive table-secondary"> | + | <div class="col-md-4 offset-md-4"> |
| − | + | <table class="table table-sm table-responsive table-secondary table-full"> | |
| − | + | <tbody> | |
| − | + | <tr> | |
| − | + | <td >SYBR</td> | |
| − | + | <td>5μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >F Primer</td> | |
| − | + | <td>0.2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >R Primer</td> | |
| − | + | <td>0.2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >ddH<sub>2</sub>O</td> | |
| − | + | <td>2.6μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >cDNA</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >Total</td> | |
| − | + | <td>10μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td colspan="2"><b>Then put them for qPCR machine</b></td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >95℃ for 10min</td> | |
| − | + | <td></td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >95℃ for 15s</td> | |
| − | + | <td rowspan="2">40 cycles</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >60℃ for 60s</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >4℃ reserved</td> | |
| − | + | <td></td> | |
| − | + | </tr> | |
| − | + | </tbody> | |
| + | </table> | ||
| + | </div> | ||
| + | |||
<h4>3.Result</h4> | <h4>3.Result</h4> | ||
<div class="col-md-10 offset-md-1"> | <div class="col-md-10 offset-md-1"> | ||
| Line 307: | Line 334: | ||
<h2>May 29</h2> | <h2>May 29</h2> | ||
<p>We chose the specifically high-expressed miRNA: miR-148b and miR-141 for qPCR, and the result was showed below.</p> | <p>We chose the specifically high-expressed miRNA: miR-148b and miR-141 for qPCR, and the result was showed below.</p> | ||
| − | <div class="col-md- | + | <div class="col-md-6 offset-md-3"> |
<img src="https://static.igem.org/mediawiki/2019/d/d6/T--CSU_CHINA--LabT2P2F2.png" alt=""> | <img src="https://static.igem.org/mediawiki/2019/d/d6/T--CSU_CHINA--LabT2P2F2.png" alt=""> | ||
</div> | </div> | ||
</div> | </div> | ||
| − | <!-- 6 --> | + | <!-- 6 6+1--> |
<div class="col-md-12" id="June"> | <div class="col-md-12" id="June"> | ||
<h2>June</h2> | <h2>June</h2> | ||
| Line 333: | Line 360: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >miR-141-BS</td> |
<td>ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA</td> | <td>ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA</td> | ||
<td>106</td> | <td>106</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >miR-148b-BS </td> |
<td>ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA</td> | <td>ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA</td> | ||
<td>110</td> | <td>110</td> | ||
| Line 349: | Line 376: | ||
<h2>June 6</h2> | <h2>June 6</h2> | ||
<h4>1. We took the synthetic sequence(miR-141-BS and miR-148b-BS) for PCR amplification</h4> | <h4>1. We took the synthetic sequence(miR-141-BS and miR-148b-BS) for PCR amplification</h4> | ||
| − | <div class="col-md- | + | <div class="col-md-6 offset-md-3"> |
<table class="table table-striped table-inverse table-sm table-responsive table-secondary table-full"> | <table class="table table-striped table-inverse table-sm table-responsive table-secondary table-full"> | ||
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
| Line 359: | Line 386: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >5X Buffer</td> |
<td>10</td> | <td>10</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >DMSO</td> |
<td>4</td> | <td>4</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >dNTP</td> |
<td>4</td> | <td>4</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Forward Primer</td> |
<td>2</td> | <td>2</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Reverse Primer</td> |
<td>2</td> | <td>2</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Targeted DNA fragment</td> |
<td>1</td> | <td>1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >phusion</td> |
<td>1</td> | <td>1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >ddH<sub>2</sub>O</td> |
<td>26</td> | <td>26</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >In Total</td> |
<td>50</td> | <td>50</td> | ||
</tr> | </tr> | ||
| Line 412: | Line 439: | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| − | </div> | + | </div> |
| − | + | ||
<h4>2. Then, we checked the result of PCR through agarose gel electrophoresis（1% agarose gel；110V for 30min）</h4> | <h4>2. Then, we checked the result of PCR through agarose gel electrophoresis（1% agarose gel；110V for 30min）</h4> | ||
<h4>3. We cut the fragments of gel and performed purification</h4> | <h4>3. We cut the fragments of gel and performed purification</h4> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table table-sm table-inverse table-responsive table-secondary"> | + | <table class="table table-sm table-inverse table-responsive table-secondary table-full"> |
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr> | <tr> | ||
| Line 425: | Line 451: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >PE Buffer</td> |
<td>750μl/per column</td> | <td>750μl/per column</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >PB Buffer</td> |
<td>50μl</td> | <td>50μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Elution Buffer</td> |
<td>30μl</td> | <td>30μl</td> | ||
</tr> | </tr> | ||
| Line 445: | Line 471: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >PE Buffer</td> |
<td>600μl</td> | <td>600μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >EB Buffer</td> |
<td>50μl</td> | <td>50μl</td> | ||
</tr> | </tr> | ||
| Line 461: | Line 487: | ||
<h2>June 7</h2> | <h2>June 7</h2> | ||
<h4>1.We digested the two binding sites with the same incision enzyme with the vector (LSBr5and3), then we connected BS and vector together.</h4> | <h4>1.We digested the two binding sites with the same incision enzyme with the vector (LSBr5and3), then we connected BS and vector together.</h4> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | + | <table class="table table-striped table-inverse table-sm table-responsive table-secondary table-full" > | |
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td><b>Digestion</b></td> |
<td>DNA </td> | <td>DNA </td> | ||
<td>Vector</td> | <td>Vector</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td>In Total</td> |
<td>10</td> | <td>10</td> | ||
<td>15</td> | <td>15</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td>Kpn11</td> |
<td>1</td> | <td>1</td> | ||
<td>1</td> | <td>1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td>Xho1</td> |
<td>1</td> | <td>1</td> | ||
<td>1</td> | <td>1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td>10XBuffer</td> |
<td>2</td> | <td>2</td> | ||
<td>2</td> | <td>2</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td>ddH<sub>2</sub>O</td> |
<td>6</td> | <td>6</td> | ||
<td>11</td> | <td>11</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2"><b>Connection</b></td> |
<td>Volume</td> | <td>Volume</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">Fragment</td> |
<td>3μl</td> | <td>3μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">Vector</td> |
<td>10μl</td> | <td>10μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">10XBuffer</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">T<sub>4</sub> DNA Ligase</td> |
<td>3μl</td> | <td>3μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">ddH<sub>2</sub>O</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">Total</td> |
<td>20μl</td> | <td>20μl</td> | ||
</tr> | </tr> | ||
| Line 527: | Line 553: | ||
<h4>2.We got the recombined plasmids to translate them to the competent E.coli cells</h4> | <h4>2.We got the recombined plasmids to translate them to the competent E.coli cells</h4> | ||
| − | <table class="table table-sm table-inverse table-responsive table-secondary"> | + | <table class="table table-sm table-inverse table-responsive table-secondary table-full"> |
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >PGL4.22-Promoter</td> |
<td>0ng</td> | <td>0ng</td> | ||
<td>5 ng</td> | <td>5 ng</td> | ||
| Line 537: | Line 563: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >β-Gal(line lacZ)</td> |
<td>10ng</td> | <td>10ng</td> | ||
<td>10 ng</td> | <td>10 ng</td> | ||
| Line 544: | Line 570: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Empty </td> |
<td>90 ng</td> | <td>90 ng</td> | ||
<td>85 ng</td> | <td>85 ng</td> | ||
| Line 551: | Line 577: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="5">The total plasmid DNA content of each hole (12 holes in total) in the 24-well plate was 100ng.According to the Lipomax: DNA = 3 mu l;The 100ng ratio is configured with the following optin mixture</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >+25μl Optin-DNA</td> |
<td colspan="4">Incubate 5min</td> | <td colspan="4">Incubate 5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >+25μl Optin-Lipomax</td> |
<td colspan="4">incubate5min</td> | <td colspan="4">incubate5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="5">Blend, then incubate for 20min（the system has a total of 50μl）</td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
| Line 572: | Line 598: | ||
<h2>June 8</h2> | <h2>June 8</h2> | ||
<p>We transferred the bacteria cells to the solid LB medium with Amp<sup>+</sup></p> | <p>We transferred the bacteria cells to the solid LB medium with Amp<sup>+</sup></p> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
<table class="table table-sm table-inverse table-responsive table-secondary table-full"> | <table class="table table-sm table-inverse table-responsive table-secondary table-full"> | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td colspan="2">Solid LB medium with Amp<sup>+</sup></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >LB medium （liquid）</td> |
<td>3.96ml</td> | <td>3.96ml</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Amp</td> |
<td>4μl</td> | <td>4μl</td> | ||
</tr> | </tr> | ||
| Line 602: | Line 628: | ||
</div> | </div> | ||
| − | <!-- 7 --> | + | <!-- 7 7+1--> |
<div class="col-md-12" id="July"> | <div class="col-md-12" id="July"> | ||
<h2>July</h2> | <h2>July</h2> | ||
| Line 615: | Line 641: | ||
<h2>July 13</h2> | <h2>July 13</h2> | ||
<p>We purchased the primer of sponge of two miRNA: miR-141 and miR-148b</p> | <p>We purchased the primer of sponge of two miRNA: miR-141 and miR-148b</p> | ||
| − | <div class="col-md- | + | <div class="col-md-6 offset-md-3"> |
<table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> | <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> | ||
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
| Line 625: | Line 651: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-miR-141-sponge</td> |
<td>CGTCTCCAGCCGTAGAAGGA</td> | <td>CGTCTCCAGCCGTAGAAGGA</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-miR-141-sponge</td> |
<td>CGTCTCCCGAGCATCTTCCT</td> | <td>CGTCTCCCGAGCATCTTCCT</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-miR-148b-sponge</td> |
<td>CGTCTCCAGCCACAAAGTTG</td> | <td>CGTCTCCAGCCACAAAGTTG</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-miR-148b-sponge</td> |
<td>CGTCTCCCGAGTCAGTGCAT</td> | <td>CGTCTCCCGAGTCAGTGCAT</td> | ||
</tr> | </tr> | ||
| Line 649: | Line 675: | ||
<h2>July 15</h2> | <h2>July 15</h2> | ||
<p>We got the primer and took up for PCR amplification</p> | <p>We got the primer and took up for PCR amplification</p> | ||
| − | <div class="col-md- | + | <div class="col-md-6 offset-md-3"> |
<table class="table table-striped table-inverse table-sm table-responsive table-secondary table-full"> | <table class="table table-striped table-inverse table-sm table-responsive table-secondary table-full"> | ||
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
| Line 659: | Line 685: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >5X Buffer</td> |
<td>10</td> | <td>10</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >DMSO</td> |
<td>4</td> | <td>4</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >dNTP</td> |
<td>4</td> | <td>4</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Forward Primer</td> |
<td>2</td> | <td>2</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Reverse Primer</td> |
<td>2</td> | <td>2</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Targeted DNA fragment</td> |
<td>1</td> | <td>1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >phusion</td> |
<td>1</td> | <td>1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >ddH<sub>2</sub>O</td> |
<td>26</td> | <td>26</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >In Total</td> |
<td>50</td> | <td>50</td> | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
| − | </table> | + | </table> |
| − | + | </div> | |
| − | <table class="table table-inverse table-sm table-responsive table-secondary"> | + | <p>Then put the reaction system to the PCR machine</p> |
| + | <div class="col-md-6 offset-md-3"> | ||
| + | <table class="table table-inverse table-sm table-responsive table-secondary table-full"> | ||
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr> | <tr> | ||
| Line 707: | Line 735: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td ></td> |
<td>94℃</td> | <td>94℃</td> | ||
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td rowspan="3">10 cycles Add 0.5℃ after per cycle</td> |
<td>94℃</td> | <td>94℃</td> | ||
<td>30s</td> | <td>30s</td> | ||
| Line 725: | Line 753: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td rowspan="3">25 cycles</td> |
<td>94℃</td> | <td>94℃</td> | ||
<td>30s</td> | <td>30s</td> | ||
| Line 738: | Line 766: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td ></td> |
<td>72℃</td> | <td>72℃</td> | ||
<td>7min</td> | <td>7min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td ></td> |
<td>4℃</td> | <td>4℃</td> | ||
<td>reserved</td> | <td>reserved</td> | ||
| Line 760: | Line 788: | ||
</div> | </div> | ||
| − | <div class="col-md-12" id=" | + | <div class="col-md-12" id="July17"> |
<h2>July 17</h2> | <h2>July 17</h2> | ||
<p>We gauged the efficiency of Sponge expression through luciferase assay </p> | <p>We gauged the efficiency of Sponge expression through luciferase assay </p> | ||
| Line 768: | Line 796: | ||
<h2>July 25</h2> | <h2>July 25</h2> | ||
<p>We designed the primer of the three synthetic promoters used for three Modules</p> | <p>We designed the primer of the three synthetic promoters used for three Modules</p> | ||
| − | <div class="col-md- | + | <div class="col-md-6 offset-md-3"> |
<table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> | <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-ESR1-EcoRI</td> |
<td>CCGGAATTCATGACCATGACCCTCCAC</td> | <td>CCGGAATTCATGACCATGACCCTCCAC</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-ESR1-BamHI</td> |
<td>CGCGGATCCTCAGACCGTGGCAGGGAA</td> | <td>CGCGGATCCTCAGACCGTGGCAGGGAA</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-GATA3-EcoRI</td> |
<td>CCGGAATTCATGGAGGTGACGGCGGAC</td> | <td>CCGGAATTCATGGAGGTGACGGCGGAC</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-GATA3-BamHI</td> |
<td>CGCGGATCCCTAACCCATGGCGGTGAC</td> | <td>CGCGGATCCCTAACCCATGGCGGTGAC</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-G8p-XhoI</td> |
<td>CCGCTCGAGTTTACCAACAGTACCGGA</td> | <td>CCGCTCGAGTTTACCAACAGTACCGGA</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-lateADEp-XhoI</td> |
<td>CCGCTCGAGAGAGTGAGGACGAACGCC</td> | <td>CCGCTCGAGAGAGTGAGGACGAACGCC</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-G8p-SacI</td> |
<td>CGAGCTCCGATAGGTACCGAGTTTC</td> | <td>CGAGCTCCGATAGGTACCGAGTTTC</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-G8p-KpnI</td> |
<td>CGGGGTACCCGATAGGTACCGAGTTTC</td> | <td>CGGGGTACCCGATAGGTACCGAGTTTC</td> | ||
</tr> | </tr> | ||
| Line 806: | Line 834: | ||
</table> | </table> | ||
</div> | </div> | ||
| − | |||
</div> | </div> | ||
| Line 823: | Line 850: | ||
</div> | </div> | ||
| − | <!-- 8 --> | + | <!-- 8 A+1--> |
<div class="col-md-12" id="August"> | <div class="col-md-12" id="August"> | ||
<h2>August</h2> | <h2>August</h2> | ||
| Line 874: | Line 901: | ||
<p>We constructed pLN431-s(GATA3)p</p> | <p>We constructed pLN431-s(GATA3)p</p> | ||
<p>Golden gate method to connect the elements </p> | <p>Golden gate method to connect the elements </p> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table | + | <table class="table table-inverse table-responsive table-secondary table-striped table-full"> |
| − | + | <tbody> | |
| − | + | <tr> | |
| − | + | <td >pLN431 plasmid</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >s(GATA3)p</td> | |
| − | + | <td>1μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >10XT<sub>4</sub> Ligase Buffer</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >10XBuffer</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >BsmBI </td> | |
| − | + | <td>1μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >ddH<sub>2</sub>O</td> | |
| − | + | <td>12l</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >Total</td> | |
| − | + | <td>20μl</td> | |
| − | + | </tr> | |
| − | + | </tbody> | |
| − | + | </table> | |
<p>Then, we amplified them by PCR</p> | <p>Then, we amplified them by PCR</p> | ||
| − | + | <table class="table table-striped table-inverse table-responsive table-secondary table-full" > | |
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr> | <tr> | ||
| Line 916: | Line 943: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >37℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >16℃</td> |
<td>10min</td> | <td>10min</td> | ||
</tr> | </tr> | ||
| Line 931: | Line 958: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >37℃</td> |
<td>15min</td> | <td>15min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >50℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >80℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
| Line 950: | Line 977: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >16℃</td> |
<td>reserved</td> | <td>reserved</td> | ||
</tr> | </tr> | ||
| Line 969: | Line 996: | ||
<h2>August 16</h2> | <h2>August 16</h2> | ||
<h4>1. pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b) </h4> | <h4>1. pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b) </h4> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table table-sm table-inverse table-responsive table-secondary table-striped"> | + | <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> |
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Vector</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >miR141-Sponge</td> |
<td>1μl</td> | <td>1μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >s(ESR1)p</td> |
<td>1μl</td> | <td>1μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >10XT4 Ligase Buffer</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >10XBuffer</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >BsmBI</td> |
<td>1μl</td> | <td>1μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >ddH<sub>2</sub>O</td> |
<td>11μl</td> | <td>11μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Total</td> |
<td>20μl</td> | <td>20μl</td> | ||
</tr> | </tr> | ||
| Line 1,008: | Line 1,035: | ||
</div> | </div> | ||
<h4>2. pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141) </h4> | <h4>2. pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141) </h4> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table table-sm table-inverse table-responsive table-secondary table-striped"> | + | <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> |
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Vector</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >miR141-Sponge</td> |
<td>1μl</td> | <td>1μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >s(ESR1)p</td> |
<td>1μl</td> | <td>1μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >10XT4 Ligase Buffer</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >10XBuffer</td> |
<td>2μl</td> | <td>2μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >BsmBI</td> |
<td>1μl</td> | <td>1μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >ddH<sub>2</sub>O</td> |
<td>11μl</td> | <td>11μl</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Total</td> |
<td>20μl</td> | <td>20μl</td> | ||
</tr> | </tr> | ||
| Line 1,047: | Line 1,074: | ||
</div> | </div> | ||
<h4>3.PCR amplification</h4> | <h4>3.PCR amplification</h4> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table table-striped table-sm table-inverse table-responsive table-secondary" > | + | <table class="table table-striped table-sm table-inverse table-responsive table-secondary table-full" > |
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr> | <tr> | ||
| Line 1,056: | Line 1,083: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >37℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >16℃</td> |
<td>10min</td> | <td>10min</td> | ||
</tr> | </tr> | ||
| Line 1,071: | Line 1,098: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >37℃</td> |
<td>15min</td> | <td>15min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >50℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >80℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
| Line 1,090: | Line 1,117: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >16℃</td> |
<td>reserved</td> | <td>reserved</td> | ||
</tr> | </tr> | ||
| Line 1,116: | Line 1,143: | ||
<h2>August 25</h2> | <h2>August 25</h2> | ||
<p>We turned to golden gate method to connect all the elements of Module1</p> | <p>We turned to golden gate method to connect all the elements of Module1</p> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table table-sm table-inverse table-responsive table-secondary table-striped"> | + | <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full"> |
| − | + | <tbody> | |
| − | + | <tr> | |
| − | + | <td >pLN431 plasmid</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >s(GATA3)p</td> | |
| − | + | <td>1μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >10XT<sub>4</sub> Ligase Buffer</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >10XBuffer</td> | |
| − | + | <td>2μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >BsmBI </td> | |
| − | + | <td>1μl</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >ddH<sub>2</sub>O</td> | |
| − | + | <td>12l</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >Total</td> | |
| − | + | <td>20μl</td> | |
| − | + | </tr> | |
| − | + | </tbody> | |
| − | + | </table> | |
</div> | </div> | ||
<p> Then, we amplified them by PCR</p> | <p> Then, we amplified them by PCR</p> | ||
| − | <div class="col-md- | + | <div class="col-md-4 offset-md-4"> |
| − | <table class="table table-striped table-sm table-inverse table-responsive table-secondary" > | + | <table class="table table-striped table-sm table-inverse table-responsive table-secondary table-full" > |
<thead class="thead-inverse"> | <thead class="thead-inverse"> | ||
<tr> | <tr> | ||
| Line 1,160: | Line 1,187: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >37℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >16℃</td> |
<td>10min</td> | <td>10min</td> | ||
</tr> | </tr> | ||
| Line 1,175: | Line 1,202: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >37℃</td> |
<td>15min</td> | <td>15min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >50℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >80℃</td> |
<td>5min</td> | <td>5min</td> | ||
</tr> | </tr> | ||
| Line 1,194: | Line 1,221: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >16℃</td> |
<td>reserved</td> | <td>reserved</td> | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| − | |||
</div> | </div> | ||
<p></p> | <p></p> | ||
<div class="col-md-10 offset-md-1"> | <div class="col-md-10 offset-md-1"> | ||
| + | <img src="https://static.igem.org/mediawiki/2019/9/95/T--CSU_CHINA--LabT7P1F7.1.1.png" alt=""> | ||
<img src="https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--LabT7P1F7.1.2.png" alt=""> | <img src="https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--LabT7P1F7.1.2.png" alt=""> | ||
</div> | </div> | ||
</div> | </div> | ||
| − | <!-- 9 --> | + | <!-- 9 A+1--> |
<div class="col-md-12" id="September"> | <div class="col-md-12" id="September"> | ||
<h2>September</h2> | <h2>September</h2> | ||
| Line 1,221: | Line 1,248: | ||
<div class="col-md-12" id="September2"> | <div class="col-md-12" id="September2"> | ||
<h2>September 2</h2> | <h2>September 2</h2> | ||
| − | <div class="col-md- | + | <div class="col-md-6 offset-md-3"> |
| − | <table class="table table-sm table-inverse table-responsive table-secondary"> | + | <table class="table table-sm table-inverse table-responsive table-secondary table-full"> |
| − | + | <tbody> | |
| − | + | <tr> | |
| − | + | <td >R-G8p-XhoI</td> | |
| − | + | <td>CCGCTCGAGTTTACCAACAGTACCGGA</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td>R-lateADEp-XhoI</td> | |
| − | + | <td>CCGCTCGAGAGAGTGAGGACGAACGCC</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >SF-G8p-SacI</td> | |
| − | + | <td>CGAGCTCCGATAGGTACCGAGTTTC</td> | |
| − | + | </tr> | |
| − | + | <tr> | |
| − | + | <td >F-G8p-KpnI</td> | |
| − | + | <td>CGGGGTACCCGATAGGTACCGAGTTTC</td> | |
| − | + | </tr> | |
| − | + | </tbody> | |
| − | + | </table> | |
</div> | </div> | ||
| − | |||
</div> | </div> | ||
| Line 1,284: | Line 1,310: | ||
<tbody> | <tbody> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-s(ESR1)p-BsmBI</td> |
<td>GCCATCGTCTCCACTGAGGTCACGGTGACCT</td> | <td>GCCATCGTCTCCACTGAGGTCACGGTGACCT</td> | ||
</tr> | </tr> | ||
| Line 1,292: | Line 1,318: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-miR141spe-EcoRI</td> |
<td>CCGGAATTCGCCGTAGAAGGAATGTCA</td> | <td>CCGGAATTCGCCGTAGAAGGAATGTCA</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-miR141spe-BamHI</td> |
<td>CGCGGATCCGAGCATCTTCCTTACAGT</td> | <td>CGCGGATCCGAGCATCTTCCTTACAGT</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-miR148bspe-EcoRI</td> |
<td>CCGGAATTCGCCACAAAGTTGTGAAAT</td> | <td>CCGGAATTCGCCACAAAGTTGTGAAAT</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >R-miR148bspe-BamHI</td> |
<td>CGCGGATCCGAGTCAGTGCATTTCA</td> | <td>CGCGGATCCGAGTCAGTGCATTTCA</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >F-s(ESR1)p-KpnI</td> |
<td>CGGGGTACCAGGTCACGGTGACCTTCT</td> | <td>CGGGGTACCAGGTCACGGTGACCTTCT</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Sponge-141-BsmBI</td> |
<td>CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG</td> | <td>CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td | + | <td >Sponge-148b-BsmBI</td> |
<td>CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG</td> | <td>CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG</td> | ||
</tr> | </tr> | ||
| Line 1,373: | Line 1,399: | ||
</div> | </div> | ||
| − | <!-- 10 --> | + | <!-- 10 3+1--> |
<div class="col-md-12" id="October"> | <div class="col-md-12" id="October"> | ||
<h2>October</h2> | <h2>October</h2> | ||
| Line 1,404: | Line 1,430: | ||
<h2>October 9</h2> | <h2>October 9</h2> | ||
<p>We left the same cells as Octo.8 after being transfected for the two days , here were the results.</p> | <p>We left the same cells as Octo.8 after being transfected for the two days , here were the results.</p> | ||
| − | <img src="https://static.igem.org/mediawiki/2019/a/a3/T--CSU_CHINA--NOct9.1.png" alt=""> | + | <div class="col-md-8 offset-md-2"> |
| − | + | <img src="https://static.igem.org/mediawiki/2019/a/a3/T--CSU_CHINA--NOct9.1.png" alt=""> | |
| − | + | <h5>Fig.3 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day2</h5> | |
| − | + | <img src="https://static.igem.org/mediawiki/2019/4/40/T--CSU_CHINA--NOct9.2.png" alt=""> | |
| + | <h5>Fig.4 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day2</h5> | ||
| + | </div> | ||
</div> | </div> | ||
| Line 1,425: | Line 1,453: | ||
<script> | <script> | ||
| − | $( | + | $("#navbar_LAB").addClass("active"); |
| + | /*导航****************************************************/ | ||
| + | $("#sidebar img").click(function(){ | ||
| + | $("#navfig").toggle(); | ||
| + | }); | ||
| + | /*日历****************************************************/ | ||
| + | //数据 | ||
| + | var month_normal = [31,28,31,30,31,30,31,31,30,31,30,31]; | ||
| + | var month_name = ["January","Febrary","March","April","May","June","July","August","September","October","November","December"]; | ||
| + | var wdata = [ ["13","16","21","22","25","27","29"],//May | ||
| + | ["3","6","7","8","9","10"],//June | ||
| + | ["13","15","16","17","24","25","28","30"],//July | ||
| + | ["2","5","6","8","11","12","16","20","24","25"],//Auguest | ||
| + | ["2","5","9","11","13","15","20","21","24","25"],//September | ||
| + | ["8","9","10"]//October | ||
| + | ]; | ||
| + | //根据年月获取当月第一天是周几 | ||
| + | function dayStart(month){ | ||
| + | var tmpDate = new Date(2019, month, 1); | ||
| + | return (tmpDate.getDay()); | ||
| + | }; | ||
| + | //数据加载 | ||
| + | function refreshDate(my_month){ | ||
| + | var obj = new Array; | ||
| + | //计算当月的天数和每月第一天都是周几 | ||
| + | var firstDay = dayStart(my_month); | ||
| + | //添加每个月的空白部分 | ||
| + | for(var i = 0; i < firstDay; i++) obj.push(""); | ||
| + | //每月的日子 | ||
| + | for(var i = 1; i <= month_normal[my_month]; i++) obj.push(i.toString()); | ||
| + | //清空 | ||
| + | $("#cal-body").empty(); | ||
| + | //月份 | ||
| + | $("#cal-month").text(month_name[my_month]); | ||
//数据 | //数据 | ||
| − | + | $("#cal-body").append("<tr>"); | |
| − | + | var i=0; | |
| − | var | + | for(; i<obj.length; i++ ){ |
| − | + | $("#cal-body").append("<td>"+obj[i]+"</td>"); | |
| − | + | if(i%7==6) $("#cal-body").append("</tr><tr>"); | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
}; | }; | ||
| − | // | + | //填空 |
| − | + | var l = 7-i%7; | |
| − | + | for(var j=0; j<l; j++) $("#cal-body").append("<td></td>"); | |
| − | + | $("#cal-body").append("</tr>"); | |
| − | + | //加载样式 | |
| − | + | $("#cal-body").children().each(function(){ | |
| − | + | if($.inArray($(this).text(),wdata[my_month-4])==-1) | |
| − | + | $(this).addClass("text-muted"); | |
| − | + | else | |
| − | + | $(this).addClass("text-danger"); | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
}); | }); | ||
| − | // | + | //点击跳转 |
$("#cal-body .text-danger").click(function(){ | $("#cal-body .text-danger").click(function(){ | ||
| + | $("#parCont").children().hide(); | ||
$("#cal-body .table-info").removeClass("table-info"); | $("#cal-body .table-info").removeClass("table-info"); | ||
$(this).addClass("table-info"); | $(this).addClass("table-info"); | ||
| − | + | $("#"+$("#cal-month").text()).show(); | |
| − | window.location.href = | + | $("#"+$("#cal-month").text() + $(this).text()).show(); |
| + | window.location.href = "#"+$("#cal-month").text(); | ||
}); | }); | ||
| + | }; | ||
| + | //月向前 | ||
| + | $("#pre").click(function(){ | ||
| + | var m = $("#cal-month").data("month"); | ||
| + | if(m > 4){ | ||
| + | $("#cal-month").data("month", m-1); | ||
| + | refreshDate(m-1); | ||
| + | } | ||
| + | }); | ||
| + | //月向后 | ||
| + | $("#next").click(function(){ | ||
| + | var m = $("#cal-month").data("month"); | ||
| + | if(m < 9){ | ||
| + | $("#cal-month").data("month", m+1); | ||
| + | refreshDate(m+1); | ||
| + | } | ||
| + | }); | ||
| + | //天向前 | ||
| + | $("#pred").click(function(){ | ||
| + | if($("#sidebar .table-info").prevUntil("",".text-danger").length == 0){ | ||
| + | if($("#cal-month").data("month") > 4){ | ||
| + | $("#pre").click(); | ||
| + | $("#sidebar .text-danger:last").click(); | ||
| + | } | ||
| + | } | ||
| + | else $("#sidebar .table-info").prevUntil("",".text-danger:first").click(); | ||
| + | }); | ||
| + | //天向后 | ||
| + | $("#nextd").click(function(){ | ||
| + | if($("#sidebar .table-info ").nextUntil("",".text-danger").length == 0){ | ||
| + | if($("#cal-month").data("month") < 9){ | ||
| + | $("#next").click(); | ||
| + | $("#sidebar .text-danger:first").click(); | ||
| + | } | ||
| + | } | ||
| + | else $("#sidebar .table-info").nextUntil("",".text-danger:first").click(); | ||
| + | }); | ||
| + | |||
| + | //初始化 | ||
| + | $(document).ready(function(){ | ||
| + | $("#mob").click(function(){ | ||
| + | $("#sidebar").toggle(); | ||
| + | }); | ||
| + | refreshDate($("#cal-month").data("month")); | ||
| + | $("#parCont").children().hide(); | ||
| + | //加载 | ||
| + | setTimeout(function(){ | ||
| + | $("#labLoad").hide(); | ||
| + | }, 800) | ||
}); | }); | ||
</script> | </script> | ||
| − | |||
| − | |||
</body> | </body> | ||
</html> | </html> | ||
Revision as of 16:41, 16 November 2019
loading……
| 2019 | May | |||||
|---|---|---|---|---|---|---|
| SUN | MON | TUE | WED | THU | FRI | SAT |
NOTEBOOK
May
Main tasks
May 13-25
Screening TNBC specific Transcription factors (TFs)
May 27-29
Screening of low-expressed miRNA in TNBC
May 13
We screened for high-expressed genes in tumor groups in all invasive breast cancer from GEPIA database. Then, 245 genes is selected initially. 86 normal breast transcriptome samples and 303 tumor transcriptome samples were downloaded from TCGA (The Cancer Genome Atlas) database. The differentially expressed genes were screened by EdgeR algorithm. And all genes were selected in the GEPIA results set (245).
May 16
We used the GEPIA database to test the most specific differential-expressed gene in invasive breast cancer, and found out that 11 overlaps with the previously selected 245. Following the priority order for transcription factor identification, 9 transcription factors were identified.
May 21
Today we designed the primer of 9 TFs for PCR, and verified the expression of 9 selected TFs with qPCR.
May 22
Through RT reaction of mRNA and qPCR towards the cDNA, we got the results of qPCR. According to the expression in TNBC cell lines and normal cell lines, We chose ESR1 and GATA3 to design synthetic promoters.
May 25
We checked the potential specific miRNA in TNBC cells from articles and verified from TGCA database, then we purchased the primers of these miRNAs and amplified them The miRNAs we chose: miR-148b , miR-591, miR-125b, miR-34c-3p, miR-26a/26b, miR-216b, miR-101, miR-340, miR-409-3p, miR-489, miR-141, miR146a, miR-542-3p, miR-135a
May 27
1.We performed reverse transcription on miRNA and got these cDNA
| Step | Temperature | Time |
|---|---|---|
| Reverse transcription | 16℃ | 30min |
| 42℃ | 30min | |
| Stop reaction | 85℃ | 5min |
| Hold | 4℃ | Hold |
2.Then we utilized these cDNA for qPCR
| SYBR | 5μl |
| F Primer | 0.2μl |
| R Primer | 0.2μl |
| ddH2O | 2.6μl |
| cDNA | 2μl |
| Total | 10μl |
| Then put them for qPCR machine | |
| 95℃ for 10min | |
| 95℃ for 15s | 40 cycles |
| 60℃ for 60s | |
| 4℃ reserved | |
3.Result
May 29
We chose the specifically high-expressed miRNA: miR-148b and miR-141 for qPCR, and the result was showed below.
June
Main Tasks
June 3-10
Construction and examination of Binding Sites
June 3
We purchased the service of synthesizing the whole sequence for binding sites of miR-141 and miR-148b(then got the miR-141-BS and miR-148b-BS) from Sangon Biotech.
| Items | Sequence ( 5‘→3’) | Length |
|---|---|---|
| miR-141-BS | ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA | 106 |
| miR-148b-BS | ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA | 110 |
June 6
1. We took the synthetic sequence(miR-141-BS and miR-148b-BS) for PCR amplification
| Reagent | Volume(μl) |
|---|---|
| 5X Buffer | 10 |
| DMSO | 4 |
| dNTP | 4 |
| Forward Primer | 2 |
| Reverse Primer | 2 |
| Targeted DNA fragment | 1 |
| phusion | 1 |
| ddH2O | 26 |
| In Total | 50 |
| 95℃ for 10min | |
| 95℃ for 15s | n cycles |
| n℃ for 60s | |
| 4℃ reserved |
2. Then, we checked the result of PCR through agarose gel electrophoresis（1% agarose gel；110V for 30min）
3. We cut the fragments of gel and performed purification
| PCR production purification | |
|---|---|
| PE Buffer | 750μl/per column |
| PB Buffer | 50μl |
| Elution Buffer | 30μl |
| Gel recycling | |
| PE Buffer | 600μl |
| EB Buffer | 50μl |
Finally, we got the amplified products of miR-141-BS and miR-148b-BS and made them stored at -20℃
June 7
1.We digested the two binding sites with the same incision enzyme with the vector (LSBr5and3), then we connected BS and vector together.
| Digestion | DNA | Vector |
| In Total | 10 | 15 |
| Kpn11 | 1 | 1 |
| Xho1 | 1 | 1 |
| 10XBuffer | 2 | 2 |
| ddH2O | 6 | 11 |
| Connection | Volume | |
| Fragment | 3μl | |
| Vector | 10μl | |
| 10XBuffer | 2μl | |
| T4 DNA Ligase | 3μl | |
| ddH2O | 2μl | |
| Total | 20μl | |
2.We got the recombined plasmids to translate them to the competent E.coli cells
| PGL4.22-Promoter | 0ng | 5 ng | 10 ng | 20 ng |
| β-Gal(line lacZ) | 10ng | 10 ng | 10 ng | 10 ng |
| Empty | 90 ng | 85 ng | 80 ng | 70 ng |
| The total plasmid DNA content of each hole (12 holes in total) in the 24-well plate was 100ng.According to the Lipomax: DNA = 3 mu l;The 100ng ratio is configured with the following optin mixture | ||||
| +25μl Optin-DNA | Incubate 5min | |||
| +25μl Optin-Lipomax | incubate5min | |||
| Blend, then incubate for 20min（the system has a total of 50μl） | ||||
3.We cultured the bacteria cells with concussion for 12h
June 8
We transferred the bacteria cells to the solid LB medium with Amp+
| Solid LB medium with Amp+ | |
| LB medium （liquid） | 3.96ml |
| Amp | 4μl |
June 9
We picked up the AmpR+ cells and put miRNA mimics of miR-141 and miR-148b to the liquid medium
June 10
We took these cells for FACS gauging and observed the rate of different colors expressed by cells
July
Main Tasks
July 13-24
Construction of Sponge and gauging efficiency of Sponge
July 25-30
Construction of Synthetic Promoter and gauging efficiency of promoter (Partly, the rest was done in August)
July 13
We purchased the primer of sponge of two miRNA: miR-141 and miR-148b
| Items | Sequence(5’→3’) |
|---|---|
| F-miR-141-sponge | CGTCTCCAGCCGTAGAAGGA |
| R-miR-141-sponge | CGTCTCCCGAGCATCTTCCT |
| F-miR-148b-sponge | CGTCTCCAGCCACAAAGTTG |
| R-miR-148b-sponge | CGTCTCCCGAGTCAGTGCAT |
July 15
We got the primer and took up for PCR amplification
| Reagent | Volume(μl) |
|---|---|
| 5X Buffer | 10 |
| DMSO | 4 |
| dNTP | 4 |
| Forward Primer | 2 |
| Reverse Primer | 2 |
| Targeted DNA fragment | 1 |
| phusion | 1 |
| ddH2O | 26 |
| In Total | 50 |
Then put the reaction system to the PCR machine
| Cycle | Temperature | Time |
|---|---|---|
| 94℃ | 5min | |
| 10 cycles Add 0.5℃ after per cycle | 94℃ | 30s |
| 55℃ | 30s | |
| 72℃ | 30s | |
| 25 cycles | 94℃ | 30s |
| 60℃ | 30s | |
| 72℃ | 30s | |
| 72℃ | 7min | |
| 4℃ | reserved |
We took the products for agarose gel electrophoresis
We cut the fragments of gel and performed purification
Finally, we got the amplified products of Sponge-miR-141 and Sponge-miR-148b and stored at -20℃
July 16
We chose to construct the plasmid pEGFP-N1-sponge141_148b. Through double digestion towards the plasmid and the two Sponge, we made them connected and translated them to the competent E.coli cells
July 17
We gauged the efficiency of Sponge expression through luciferase assay
July 25
We designed the primer of the three synthetic promoters used for three Modules
| F-ESR1-EcoRI | CCGGAATTCATGACCATGACCCTCCAC |
| R-ESR1-BamHI | CGCGGATCCTCAGACCGTGGCAGGGAA |
| F-GATA3-EcoRI | CCGGAATTCATGGAGGTGACGGCGGAC |
| R-GATA3-BamHI | CGCGGATCCCTAACCCATGGCGGTGAC |
| R-G8p-XhoI | CCGCTCGAGTTTACCAACAGTACCGGA |
| R-lateADEp-XhoI | CCGCTCGAGAGAGTGAGGACGAACGCC |
| F-G8p-SacI | CGAGCTCCGATAGGTACCGAGTTTC |
| F-G8p-KpnI | CGGGGTACCCGATAGGTACCGAGTTTC |
July 28
We designed the structure of s(GATA3)p for Module1
Plasmid: PGL4.22-s(GATA3)p
July 30
We designed the structure of s(GATA3)p for Module1
Plasmid: PGL4.22-s(GATA3)p
August
Main Tasks
August 6-20
Golden Gate method for connection
August 24-30
Construction of Module1
August 2
We designed the structure of s(ESR1)p for Module3
Plasmid: pGL4.22-G8p
August 5
We tested the efficiency of promoters.
Plasmid: pGL4.22-hTERT
August 6
We utilized Golden gate method to connect Module1 and Module2
Plasmid: pEGFP-N1-lacZ
August 8
We constructed the plasmid for Module1
Promoter region: BsmBI RS-s(GATA3)p-BsmBI RS; screening and identification region: BsmBI RS-lacZp-lacZ-BsmBI RS
August 11
We constructed pLN431-s(GATA3)p
Golden gate method to connect the elements
| pLN431 plasmid | 2μl |
| s(GATA3)p | 1μl |
| 10XT4 Ligase Buffer | 2μl |
| 10XBuffer | 2μl |
| BsmBI | 1μl |
| ddH2O | 12l |
| Total | 20μl |
Then, we amplified them by PCR
| Step 1(X10) | |
|---|---|
| 37℃ | 5min |
| 16℃ | 10min |
| Step 2 | |
| 37℃ | 15min |
| 50℃ | 5min |
| 80℃ | 5min |
| Step 3 | |
| 16℃ | reserved |
August 12
We constructed the plasmid for Module2
August 16
1. pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b)
| Vector | 2μl |
| miR141-Sponge | 1μl |
| s(ESR1)p | 1μl |
| 10XT4 Ligase Buffer | 2μl |
| 10XBuffer | 2μl |
| BsmBI | 1μl |
| ddH2O | 11μl |
| Total | 20μl |
2. pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141)
| Vector | 2μl |
| miR141-Sponge | 1μl |
| s(ESR1)p | 1μl |
| 10XT4 Ligase Buffer | 2μl |
| 10XBuffer | 2μl |
| BsmBI | 1μl |
| ddH2O | 11μl |
| Total | 20μl |
3.PCR amplification
| Step 1(X10) | |
|---|---|
| 37℃ | 5min |
| 16℃ | 10min |
| Step 2 | |
| 37℃ | 15min |
| 50℃ | 5min |
| 80℃ | 5min |
| Step 3 | |
| 16℃ | reserved |
August 20
We tested the construction of Plasmid and important elements via gel electrophoresis
August 24
We got the sequences of elements of Module1
Here is the sequence of GAD
August 25
We turned to golden gate method to connect all the elements of Module1
| pLN431 plasmid | 2μl |
| s(GATA3)p | 1μl |
| 10XT4 Ligase Buffer | 2μl |
| 10XBuffer | 2μl |
| BsmBI | 1μl |
| ddH2O | 12l |
| Total | 20μl |
Then, we amplified them by PCR
| Step 1(X10) | |
|---|---|
| 37℃ | 5min |
| 16℃ | 10min |
| Step 2 | |
| 37℃ | 15min |
| 50℃ | 5min |
| 80℃ | 5min |
| Step 3 | |
| 16℃ | reserved |
September
Main tasks
September 2-11
Construction of Module3
September 13-20
Construction of Module2
September 21-29
III. Transfection with Transferrin modified liposome
September 2
| R-G8p-XhoI | CCGCTCGAGTTTACCAACAGTACCGGA |
| R-lateADEp-XhoI | CCGCTCGAGAGAGTGAGGACGAACGCC |
| SF-G8p-SacI | CGAGCTCCGATAGGTACCGAGTTTC |
| F-G8p-KpnI | CGGGGTACCCGATAGGTACCGAGTTTC |
September 5
Basic parts connecting
yCD
September 9
We constructed pLN431-G8p-yCD-(miR-BS)
September 11
We translated the plasmid to E.coli and transferred them to Amp+ solid medium , then picked the single bacterial colony for sequencing whether the plasmid was constructed correctly
September 13
We connected the elements of Module2 with Golden gate method and amplified.
1.Basic plasmid: pEGFP-N1-LacZ
2.Elements of Module2
PEGFP-N1- LacZ-s(ESR1)p Sponge
3.Connection by Golden gate method and constructing the whole Module2
We constructed pEGFP-N1-LacZ-miR148b-sponge; pEGFP-N1-LacZ-miR141-sponge; pEGFP-N1-LacZ-miR101-sponge
4.Amplification of Module2
| F-s(ESR1)p-BsmBI | GCCATCGTCTCCACTGAGGTCACGGTGACCT |
| R-s(ESR1)p-BsmBI | CGATTCGTCTCCGGCTAGAGTGAGGACGAA |
| F-miR141spe-EcoRI | CCGGAATTCGCCGTAGAAGGAATGTCA |
| R-miR141spe-BamHI | CGCGGATCCGAGCATCTTCCTTACAGT |
| F-miR148bspe-EcoRI | CCGGAATTCGCCACAAAGTTGTGAAAT |
| R-miR148bspe-BamHI | CGCGGATCCGAGTCAGTGCATTTCA |
| F-s(ESR1)p-KpnI | CGGGGTACCAGGTCACGGTGACCTTCT |
| Sponge-141-BsmBI | CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG |
| Sponge-148b-BsmBI | CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG |
September 15
We translated the plasmid to E.coli and transferred them to Amp+ solid medium , then picked the single bacterial colony for sequencing whether the plasmid was constructed correctly
September 20
We tested when Module1+Module3 to examine whether G8p can be expressed.
September 21
We utilized the plasmid of Module1 2 3 for co-transfecting
September 24
HBL-100 with TF-NC for Day1
HBL-100 with TF-p53 for Day1
MDA-MB-231 with TF-NC for Day1
MDA-MB-231 with TF-p53 for Day1
September 2
HBL- 100 with TF-NC for Day2
HBL- 100 with TF-p53 for Day2
MDA-MB-231 with TF-NC for Day2
MDA-MB-231 with TF-p53 for Day2
DAPI Staining of MDA-MB-231 with TF-P53 For Day1
DAPI Staining of MDA-MB-231 with TF-P53 For Day2
October
Main Tasks
October 8-10
DAPI staining
October 8
We used DAPI staining method to observe the system that transfected to MBA-MD-231 and HBL-100 for one day to test whether it worked.
1.We prepared the two cell lines with transfecting the whole circuit, then operated as followed
- Wash the media with PBS for three times
- Incubate with PFA for 30-60 minutes
- Wash the media with PBS for three times
- Incubate in a solution of 1µg/ml 4,6-diamidino-2-phenylindole (DAPI) for 30 minutes
- Count cells under fluorescence microscope
2.Results
Fig.1 HBL-100 transfected with liposome for Day1
Fig.2 MDA-MB-231 transfected with liposome for Day1
October 9
We left the same cells as Octo.8 after being transfected for the two days , here were the results.
Fig.3 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day2
Fig.4 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day2
October 10
We left the same cells as Oct.8 after being transfected for the three days , then we observed obvious results differentially in TNBC cells and normal cells.
Fig.5 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day 3
Fig.6 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day3
Comparing Day2 and Day3, we noticed that the whole system transfected to MDA-MB-231 cells successfully worked and killed TNBC cells efficiently and specifically.