Team:CSU CHINA/LabTasks
loading……
LAB TASKS
Task One: Screening TNBC specific Transcription factors (TFs)
May 13-25
We get our idea that we can design synthetic promoters to initiate every Modules by receiving the activation of the TFs specifically expressed in human Triple Negative Breast Cancer (TNBC) cell lines, then we utilize Bioinformatics methods to screen TFs specifically low expressed in TNBC
Part I
We utilize R (Ver. 3.0.2) to analyze the data from The Cancer Genome Atlas (TCGA) database and turn to GEPIA database to find the differentially expressed TF in TNBC cells.
Then, we consider ESR1 as the best choice and six TFs (E2F1/FOXM1/FOXA1/PITX1/PTTG1/GATA3) for further examination.
Tab.1: Best choice we screen——ESR1
| TOP10 GEPIA TCGA Better choice |
Gene Symbol | Gene ID | Median (Tumor) | Median (Tumor) | Log2(Fold Change) | Percentage |
| ESR1 | ENSG00000091831.21 | 389.397 | 78.58 | 2.294 | 1 |
Tab.2: Six TFs we choose to examine further:E2F1/FOXM1/FOXA1/PITX1/PTTG1/GATA3
| TCGA | GEPIA ANOVA | GEPIA LIMMA | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GENE | logFC | logCPM | PValue | FDR | GENE | FC | P | ID | TUMOR | NORMAL | GENE | FC | P | ID | TUMOR | NORMAL |
| ESR1 | 1.665440871 | 8.646033307 | 9.29926E-11 | 3.12438E-10 | ESR1 | 2.636 | 7.79E-13 | ENSG00000091831.21 | 70.238 | 10.46 | ESR1 | 2.636 | 4.11E-23 | ENSG00000091831.21 | 70.238 | 10.46 |
| E2F1 | 2.833464601 | 4.378812917 | 1.40214E-64 | 6.6219E-63 | E2F1 | 2.048 | 9.15E-130 | ENSG00000101412.12 | 9.09 | 1.44 | E2F1 | 2.048 | 1.12E-171 | ENSG00000101412.12 | 9.09 | 1.44 |
| FOXM1 | 3.633398105 | 5.396014721 | 1.31517E-68 | 7.15612E-67 | FOXM1 | 2.902 | 1.34E-160 | ENSG00000111206.12 | 17.09 | 1.42 | FOXM1 | 2.902 | 2.19E-207 | ENSG00000111206.12 | 17.09 | 1.42 |
| PITX1 | 4.362142066 | 4.915013805 | 1.64223E-57 | 5.87336E-56 | PITX1 | 3.49 | 5.14E-119 | ENSG00000069011.15 | 14.73 | 0.4 | PITX1 | 3.49 | 3.25E-173 | ENSG00000069011.15 | 14.73 | 0.4 |
| PTTG1 | 3.383676082 | 4.430763315 | 3.09255E-78 | 2.48664E-76 | PTTG1 | 3.255 | 3.08E-208 | ENSG00000164611.12 | 40.229 | 3.32 | PTTG1 | 3.255 | 2.51E-277 | ENSG00000164611.12 | 40.229 | 3.32 |
| FOXA1 | 1.89165353 | 7.877360438 | 5.0635E-16 | 2.49821E-15 | FOXA1 | 2.934 | 1.03E-31 | ENSG00000129514.5 | 158.253 | 19.84 | FOXA1 | 2.934 | 1.04E-58 | ENSG00000129514.5 | 158.253 | 19.84 |
| GATA3-AS1 | 2.53227903 | 2.954932901 | 7.62061E-20 | 4.79732E-19 | GATA3 | 2.399 | 3.75E-31 | ENSG00000107485.15 | 251.793 | 46.921 | GATA3 | 2.399 | 8.08E-63 | ENSG00000107485.15 | 251.793 | 46.921 |
Part II
Through examinations, we choose ESR1 and GATA3 to activate the synthetic promotor for Module 1 and Module 2.
Fig.1: the expression of FOXM1、PTTG1、FOXA1、PITX1 in NC/Tumor lines
Fig.2: the expression of E2F1、GATA3 in NC/Tumor lines
Fig.3: the expression of ESR1 in NC/Tumor lines
Results: According to Fig.1-3, we observe that ESR1 and GATA3 are better differentially expressed TFs between TNBC cells and normal cells, so we utilize ESR1 to activate the synthetic promoter of Module1, and GATA3 of Module2.
Task Two: Screening of miRNA specifically expressed in TNBC
May27-29
According to articles and databases, we choose series of miRNA to examine which are specifically expressed in TNBC
Part I: qPCR for confirming the low expressed miRNA
Through miRNA reverse transcription reaction, we get the cDNA of miRNA and utilize the cDNA to examine the expression via qPCR.
Fig.1: the expression of 12 miRNAs.
Observing the result of qPCR (as Fig.1 showed), we notice that miR-146 and miR-101 are better choices for their low expression in MDA-MB-231 cells comparing to normal cells like HBL-100.
Part II: qPCR for confirming the high expressed but specific miRNA
We notice that some miRNA are specifically high expressed comparing to normal cells, which can be the substrates of their Sponge to lower their expression so that they can be the trigger specifically in TNBC cells. We focused on two miRNA: miR-148b and miR-141, Then we examined their expression, the result was showed as Fig.2.
Fig.2: the specific expression of miR-148b and miR-141;(left)HBL-100,(Right)MDA-MB-231
miR-148b and miR-141 are much higher expressed in TNBC cells comparing to normal cells. Then we can design their Sponge to bind them and lower the expression so as to trigger the initiation of Module1
Result: We finally choose miR-101, miR-146 and so on as low-expressed miRNA specifically in TNBC. Also, we choose miR-141 and miR-148b for the specifically high expression in TNBC cells and modify them for the substrates of Sponge.
Task Three: Design and test of miRNA Binding Site (miR-BS)
June 3-10
Part I: Construction of miR-BS plasmid
Plasmid: LSBr5and3
- the copy of the whole sequence of miR-BS(Tab.1)
- PCR of miR-BS
- Double Digestion on plasmid and miR-BS
- Connection of plasmid and miR-BS
- Translate them to E.coli cells
Fig.3.1.1 the structure of miR-141-BS
Fig.3.1.2 the structure of miR-148b-BS
Tab.3.1.11: the complete sequence of miR-BS
| Items | Sequence (5’→3’) | Length |
|---|---|---|
| miR-141-BS | ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA | 106 |
| miR-148b-BS | ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA | 110 |
Part II: Gauging the efficiency of miR-BS: miRNA mimics assey
- Put miRNA mimics to the E.coli cell medium
- The report genes on the plasmid will make cell take on different colors since the binding of miR-BS and miRNA after inserting the sequence of miR-BS to the region of mKate2 (transfected unsuccessfully: mKate2+mCherry can express together while transfected successfully, only mCherry can express)
- FACS gauging, we can get the efficiency of miR-BS by the rate of different colors of cell groups
Fig.3.2.1 the structure of plasmid LSBr5and3
Task Four: Design and test of Sponge
July 13-24
Part I: Sponge Design
Fig 4.1.1: the sequence of Sponge-miR141
Fig 4.1.2: the sequence of Sponge-miR148-b
Part II: the primer of Sponge and PCR amplification
Tab.4.2.1 the sequences or the primers of miR-Sponge
| Items | Sequence(5’→3’) |
|---|---|
| F-miR-141-sponge | CGTCTCCAGCCGTAGAAGGA |
| R-miR-141-sponge | CGTCTCCCGAGCATCTTCCT |
| F-miR-148b-sponge | CGTCTCCAGCCACAAAGTTG |
| R-miR-148b-sponge | CGTCTCCCGAGTCAGTGCAT |
Part III: Gauge the efficiency of expression of the Sponge
Plasmid: pEGFP-N1-sponge141_148b
We transfect the sequence of sponge into the plasmid. 24 hours after transfection, observe the results and record the expression of fluorescent protein.
Part IV : Luciferase assay
We use luciferase reporter assay kits comprising expression vectors that contain the luciferase reporter gene. To perform the reporter assay, we clone the sponge sequence upstream of the luciferase gene in the vectors then introduce that resulting vector DNA into cells, and let the cells grow for a period of time. We then collect the cells, break them open to release all the proteins (including the luciferase), add luciferin and all the necessary cofactors, and measure the enzymatic activity using a luminometer. The luciferase activity can be directly correlated with the activity of the sponge.
Task Five: Synthetic Promoter
July 25-30
Part I: Design of s(ESR1)p
Plasmid: pGL4.22-s(ESR1)p
Fig5.1.1: the structure of s(ESR1)p
Part II: Design of s(GATA3)p
Plasmid: pGL4.22-s(GATA3)p
Fig5.2.1 the structure of s(GATA3)p
Part III: Design of G8p
Plasmid: pGL4.22-G8p
Fig5.3.1 the structure of G8p
Part IV: Primer design
Tab.5.4.1 The list of primer of promoter for PCR
| F-ESR1-EcoRI | CCGGAATTCATGACCATGACCCTCCAC |
| R-ESR1-BamHI | CGCGGATCCTCAGACCGTGGCAGGGAA |
| F-GATA3-EcoRI | CCGGAATTCATGGAGGTGACGGCGGAC |
| R-GATA3-BamHI | CGCGGATCCCTAACCCATGGCGGTGAC |
| R-G8p-XhoI | CCGCTCGAGTTTACCAACAGTACCGGA |
| R-lateADEp-XhoI | CCGCTCGAGAGAGTGAGGACGAACGCC |
| F-G8p-SacI | CGAGCTCCGATAGGTACCGAGTTTC |
| F-G8p-KpnI | CGGGGTACCCGATAGGTACCGAGTTTC |
Part V: construction of synthetic promoter
We use the JASPER to get the TF binding sites (TF-BSs), and add different spacers between the tandem repeats of TF-BSs to avoid creating new binding sites in order to ensure the specificity.
Part VI: Test of promoter
1.Protomer selection
2.efficiency test
Task Six: Golden gate
August 6-20
Aiming at connecting Module1 with Module2, we utilize Golden gate method.
Part I: Basic Plasmid
Plasmid: pEGFP-N1-lacZ
Fig.6.1.1 the sequence of BsmBI-lacZp+lacZ-BsmBI
Part II: Modified design of Module1
The recognition site and cutting site of BsmBI in Module1
Part III: Modified design of Module2
1.Basic Vector: pEGFP-N1-lacZ
2.Promoter region: BsmBI RS-s(ESR1)p-BsmBI RS
3.screening and identification region: BsmBI RS-lacZp-lacZ-BsmBI RS
4.Final construction
The recognition site and cutting site of BsmBI in Module2
4.1 pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b)-（miR-148b-BS）
4.2 pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141)-（miR-141-BS）
Fig.6.3 the structure of Sponge-miR141 with BsmBI Recognition Site
Part IV: Result of construction of plasmid and important elements
Task Seven: Construction of Module1
August 24-30
Part I: construction of pLN431-s(GATA3)p-GAD-miR101-BS
- the basic plasmid:pLN431
- the promoter s(GATA3)p
- the synthetic TF: GAD——GALBD+ VP16 AD
- the binding site of miRNA: miR-101-BS
- the Golden gate connection
Fig.7.1 the process of golden gate connection for the whole Module1
Fig7.2 the whole structure of Module1 after connecting
Fig 7.3 the structure of GAD
Part II
Amplify the plasmid connected and send to sequence.
Task Eight: Design of Module2
September 13-20
Part I: Primers with enzyme recognition site
Tab.1 sequence of primers
| F-s(ESR1)p-BsmBI | GCCATCGTCTCCACTGAGGTCACGGTGACCTTCT |
| R-s(ESR1)p-BsmBI | CGATTCGTCTCCGGCTAGAGTGAGGACGAA |
| F-miR141spe-EcoRI | CCGGAATTCGCCGTAGAAGGAATGTCA |
| R-miR141spe-BamHI | CGCGGATCCGAGCATCTTCCTTACAGT |
| F-miR148bspe-EcoRI | CCGGAATTCGCCACAAAGTTGTGAAAT |
| R-miR148bspe-BamHI | CGCGGATCCGAGTCAGTGCATTTCACA |
| F-s(ESR1)p-KpnI | GGGGTACCAGGTCACGGTGACCTTCT |
Part II: Construction of pEGFP-N1-s(ESR1)p-Sponge
1. Elements and connection
1.1 Sponge of miR-141 and miR-148b
Tab.8.2 Sequence of miR-sponge with BsmBI recognition site
| Items | Sequence ( 5’→3’） | Length |
|---|---|---|
| Sponge-141-BsmBI | CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG | 225 |
| Sponge-148b-BsmBI | CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG | 226 |
1.2 basic vector: pEGFP-N1
Fig.8.2.1 the structure of vector
1.3 Promoter: s(ESR1)p
1.4 Connection: Golden gate method
| Vector | 2μl |
| miR-Sponge(miR-101;141;148b) | 1μl |
| s(ESR1)p | 1μl |
| 10XT4 Ligase Buffer | 2μl |
| 10XBuffer | 2μl |
| BsmBI | 1μl |
| ddH2O | 11μl |
| Total | 20μl |
Part III: the structure of Module2 after Golden gate connecting
Part IV
Amplify the plasmid connected and send to sequence.
Task Nine: Design of Module3
September 2-11
Part I: sequence of primers
| R-G8p-XhoI | CCGCTCGAGTTTACCAACAGTACCGGA |
| R-lateADEp-XhoI | CCGCTCGAGAGAGTGAGGACGAACGCC |
| F-G8p-SacI | CGAGCTCCGATAGGTACCGAGTTTC |
| F-G8p-KpnI | CGGGGTACCCGATAGGTACCGAGTTTC |
Part II: G8p Plasmid construction
Structure: pLN431-G8p-yCD-(miR-BS)
Fig,9.2.1 the structure of pLN431
Fig.9.2.2 the structure of G8p
Fig.9.2.3 the structure of yCD
Part III：Test when Module1+Module3 to examine whether G8p can express
Task Ten: DAPI Staining for final test whether the whole system can work
October 8-11
Comparing Day2 and Day3, we notice that the whole system transfected into MDA-MB-231 cells work successfully and kill TNBC cells efficiently and specifically.
Task Eleven: Transferrin
September 21-29
Part I Transferrin-TFR binding motif
Part II microscope observation
HBL-100 with TF-NC for Day1
HBL-100 with TF-p53 for Day1
MDA-MB-231 with TF-NC for Day1
MDA-MB-231 with TF-p53 for Day1
HBL- 100 with TF-NC for Day2
HBL- 100 with TF-p53 for Day2
MDA-MB-231 with TF-NC for Day2
