Difference between revisions of "Team:CSU CHINA/Notebook"

(Prototype team page)
 
Line 1: Line 1:
 
{{CSU_CHINA}}
 
{{CSU_CHINA}}
 
<html>
 
<html>
 +
<head>
  
 +
<meta charset="utf-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1, shrink-to-fit=no">
 +
    <meta name="author" content="ZhangB">
  
−
<div class="column full_size">
+
    <title>Notebook</title>
 +
</head>
  
−
<h1>Notebook</h1>
+
<body>
−
<p> Document the dates you worked on your project. This should be a detailed account of the work done each day for your project.</p>
+
    <style>
 +
        /* 侧边栏 */
 +
        #sidebar{
 +
            position: fixed;
 +
            top: 0px;
 +
            left: 0px;
 +
            height: 100%;
 +
            padding-top: 60px;
 +
            z-index: 10;
 +
        }
 +
        @media screen and (max-width: 768px) {
 +
            #sidebar{ display: none; }
 +
        }
 +
        #cal-title{
 +
            line-height: 30px;
 +
            font-size: 25px;
 +
            text-align: center;
 +
        }
  
−
</div>
+
        /* 日历 */
−
<div class="clear"></div>
+
        #cal-body{
 +
            font-weight: bold;
 +
        }
 +
        #cal-body .text-danger:hover{
 +
            cursor: pointer;
 +
        }
  
  
 +
        /* 全局容器 */
 +
        #ZB img,
 +
        #sidebar img{
 +
            width: 100%;
 +
            height: auto;
 +
        }
 +
        #parCont>div{
 +
            margin-top: 44px;
 +
        }
  
−
<div class="column two_thirds_size">
+
        #ZB{
−
<h3>What should this page have?</h3>
+
            background-color: #303030;
−
<ul>
+
            padding-top: 16px;
−
<li>Chronological notes of what your team is doing.</li>
+
            overflow: auto;
−
<li> Brief descriptions of daily important events.</li>
+
        }
−
<li>Pictures of your progress. </li>
+
        #ZB p{
−
<li>Mention who participated in what task.</li>
+
            font-size: 20px;
−
</ul>
+
            font-family: Times New Roman;
 +
            text-align: justify;
 +
        }
 +
        #ZB li{
 +
            font-size:  18px;
 +
            font-family: Times New Roman;
 +
            margin: 10px 0px;
 +
            text-align:justify;
 +
        }
 +
        #ZB h2{
 +
            padding: 20px 0px;
 +
            border-bottom: 1px solid white;
 +
        }
 +
        #ZB h3{
 +
            padding: 10px 0px;
 +
            font-family: Times New Roman;
 +
        }
 +
        #ZB h4{
 +
            padding-top: 15px;
 +
            font-family: Times New Roman;
 +
        }
 +
        #ZB h5{/*图标注释*/
 +
            font-size: 16px;
 +
            text-align: center;
 +
            width: 100%;
 +
            margin: 10px auto;
 +
        }
 +
        #ZB strong{
 +
            color: #B80000;
 +
        }
 +
        #ZB .table-full {
 +
            display: table !important;
 +
        }
 +
       
 +
        /* 首页 */
 +
        #LabStart{
 +
            display: -webkit-flex;
 +
            display: flex;
 +
            justify-content: center;
 +
            align-items: center;
 +
        }
 +
        #LabStart h1{
 +
            font-family: Arial Black;
 +
            color:darkgray;
 +
            text-shadow: 5px 5px 8px white;
 +
        }
  
−
</div>
+
        /* 导航图 */
 +
        #navfig{
 +
            background-image: url('https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--TimeLineS.jpg');
 +
            background-size: contain;
 +
            background-repeat: no-repeat;
 +
            background-position: center;
 +
        }
 +
    </style>
  
−
<div class="column third_size">
+
    <div class="container-fluid bg-dark fixed-top" style="height: 60px;"></div>
−
<div class="highlight decoration_A_full">
+
    <script>$("#navbar_LAB").addClass("active");</script>
−
<h3>Inspiration</h3>
+
−
<p>You can see what others teams have done to organize their notes:</p>
+
  
−
<ul>  
+
    <!-- 侧边栏 -->
−
<li><a href="https://2018.igem.org/Team:Munich/Notebook">2018 Munich</a></li>
+
    <div class="col-lg-3 col-md-4 bg-dark" id="sidebar">
−
<li><a href="https://2014.igem.org/Team:ATOMS-Turkiye/Notebook">2014 ATOMS-Turkiye</a></li>
+
        <a href="#navfig">
−
<li><a href="https://2014.igem.org/Team:Tec-Monterrey/ITESM14_project.html#tab_notebook">2014 Tec Monterrey</a></li>
+
            <img class="rounded" src="https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--TimeLineS.jpg" alt="" >
−
<li><a href="https://2014.igem.org/Team:Kyoto/Notebook/Magnetosome_Formation#title">2014 Kyoto</a></li>
+
        </a>
−
<li><a href="https://2014.igem.org/Team:Cornell/notebook">2014 Cornell</a></li>
+
 
−
</ul>
+
        <table class="table table-sm table-inverse table-responsive bg-light rounded mt-2" style="display: table;">
−
</div>
+
            <thead class="thead-inverse">
−
</div>
+
                <tr id="cal-title">
 +
                    <th colspan="3">2019</th>
 +
                    <th colspan="4" id="cal-month" data-month="4">May</th>
 +
                </tr>
 +
                <tr>
 +
                    <th>SUN</th>
 +
                    <th>MON</th>
 +
                    <th>TUE</th>
 +
                    <th>WED</th>
 +
                    <th>THU</th>
 +
                    <th>FRI</th>
 +
                    <th>SAT</th>
 +
                </tr>
 +
            </thead>
 +
            <tbody id="cal-body">
 +
            </tbody>
 +
        </table>
 +
 
 +
        <div class="btn-group w-100">
 +
            <button type="button" class="btn btn-success" id="pre">previous</button>
 +
            <button type="button" class="btn btn-success" id="next">next</button>
 +
        </div>
 +
 
 +
    </div>
 +
 
 +
    <div class="col-lg-9 offset-lg-3 col-md-8 offset-md-4  text-light" id="ZB">
 +
        <script>$("#ZB").height($(document).height()-16);</script>
 +
        <div class="row" id="parCont">
 +
            <!-- 首页 -->
 +
            <div class="col-md-12" id="LabStart">
 +
               
 +
                <h1 class="display-1">NOTEBOOK</h1>
 +
            </div>
 +
            <script>$("#LabStart").height($(document).height()-60);</script>
 +
            <!-- 导航 -->
 +
            <div class="col-md-12" id="navfig"></div>
 +
            <script>$("#navfig").height($(document).height()-16);</script>
 +
            <!-- 5 -->
 +
            <div class="col-md-12" id="May">
 +
                <h2>May</h2>
 +
                <h3>Main tasks</h3>
 +
                <h4>May 13-25</h4>
 +
                <p>Screening TNBC specific Transcription factors (TFs) </p>
 +
                <h4>May 27-29</h4>
 +
                <p>Screening of low-expressed miRNA in TNBC</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May13">
 +
                <h2>May 13</h2>
 +
                <p>
 +
                    We screened for high-expressed genes in tumor groups in all invasive breast cancer from GEPIA database. Then, 245 genes is selected initially.
 +
                    86 normal breast transcriptome samples and 303 tumor transcriptome samples were downloaded from TCGA (The Cancer Genome Atlas) database. The differentially expressed genes were screened by EdgeR algorithm. And all genes were selected in the GEPIA results set (245).
 +
                </p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May16">
 +
                <h2>1.2.May 16</h2>
 +
                <p>
 +
                    We used the GEPIA database to test the most specific differential-expressed gene in invasive breast cancer, and found out that 11 overlaps with the previously selected 245.
 +
                    Following the priority order for transcription factor identification, 9 transcription factors were identified.
 +
                </p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May21">
 +
                <h2>May 21</h2>
 +
                <p>Today we designed the primer of 9 TFs for PCR, and verified the expression of 9 selected TFs with qPCR. </p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May22">
 +
                <h2>May 22</h2>
 +
                <p>
 +
                    Through RT reaction of mRNA and qPCR towards the cDNA, we got the results of qPCR.
 +
                    According to the expression in TNBC cell lines and normal cell lines, We chose ESR1 and GATA3 to design synthetic promoters.
 +
                </p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May25">
 +
                <h2>May 25</h2>
 +
                <p>
 +
                    We checked the potential specific miRNA in TNBC cells from articles and verified from TGCA database, then we purchased the primers of these miRNAs and amplified them
 +
                    The miRNAs we chose: miR-148b , miR-591, miR-125b, miR-34c-3p, miR-26a/26b, miR-216b, miR-101, miR-340, miR-409-3p, miR-489, miR-141, miR146a, miR-542-3p, miR-135a
 +
                </p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May27">
 +
                <h2>May 27</h2>
 +
                <h4>1.We performed reverse transcription on miRNA and got these cDNA</h4>
 +
                <ol>
 +
                    <lli>Combine 3μl of 5X RT Primer and 5 μl of double-stranded template in a reaction tube.</li>
 +
                    <lli>Mix thoroughly, then centrifuge briefly to collect the contents at the bottom of the tube.</li>
 +
                    <lli>Incubate at 85℃ for 5min</li>
 +
                    <lli>Incubate at 60℃ for 5min, then place on ice</li>
 +
                    <lli>Add 7μl of RT Reaction Mix to each reaction tube. (details from “Preparing for RT Reaction Mix” showed above)</li>
 +
                    <lli>Centrifuge briefly to collect the contents at the bottom of the tubes</li>
 +
                </ol>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th>Step</th>
 +
                            <th>Temperature</th>
 +
                            <th>Time</th>
 +
                        </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row" rowspan="2">Reverse transcription</td>
 +
                                <td>16℃</td>
 +
                                <td>30min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td>42℃</td>
 +
                                <td>30min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Stop reaction</td>
 +
                                <td>85℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Hold</td>
 +
                                <td>4℃</td>
 +
                                <td>Hold</td>
 +
                            </tr>
 +
                        </tbody>
 +
                </table>
 +
                <h4>2.Then we utilized these cDNA for qPCR </h4>
 +
                <table class="table table-sm table-responsive table-secondary">
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">SYBR</td>
 +
                                <td>5μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">F Primer</td>
 +
                                <td>0.2μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">R Primer</td>
 +
                                <td>0.2μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">ddH<sub>2</sub>O</td>
 +
                                <td>2.6μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">cDNA</td>
 +
                                <td>2μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Total</td>
 +
                                <td>10μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row" colspan="2"><b>Then put them for qPCR machine</b></td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">95℃ for 10min</td>
 +
                                <td></td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">95℃ for 15s</td>
 +
                                <td rowspan="2">40 cycles</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">60℃ for 60s</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">4℃ reserved</td>
 +
                                <td></td>
 +
                            </tr>
 +
                        </tbody>
 +
                </table>
 +
                <h4>3.Result</h4>
 +
                <img src="https://static.igem.org/mediawiki/2019/1/1e/T--CSU_CHINA--LabT2P1F1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="May29">
 +
                <h2>May 29</h2>
 +
                <p>We chose the specifically high-expressed miRNA: miR-148b and miR-141 for qPCR, and the result was showed below.</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/d/d6/T--CSU_CHINA--LabT2P2F2.png" alt="">
 +
            </div>
 +
 
 +
            <!-- 6 -->
 +
            <div class="col-md-12" id="June">
 +
                <h2>June</h2>
 +
                <h3>Main Tasks</h3>
 +
                <h4>June 3-10</h4>
 +
                <p>Construction and examination of Binding Sites</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="June3">
 +
                <h2>June 3</h2>
 +
                <p>We purchased the service of synthesizing the whole sequence for binding sites of miR-141 and miR-148b(then got the miR-141-BS and miR-148b-BS) from Sangon Biotech.</p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th>Items</th>
 +
                                <th>Sequence ( 5‘→3’)</th>
 +
                                <th>Length</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">miR-141-BS</td>
 +
                                <td>ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA</td>
 +
                                <td>106</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">miR-148b-BS </td>
 +
                                <td>ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA</td>
 +
                                <td>110</td>
 +
                            </tr>
 +
                        </tbody>
 +
                </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="June6">
 +
                <h2>June 6</h2>
 +
                <h4>1. We took the synthetic sequence(miR-141-BS and miR-148b-BS) for PCR amplification</h4>
 +
                <table class="table table-striped table-inverse table-sm table-responsive table-secondary">
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th>Reagent</th>
 +
                            <th>Volume(μl)</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">5X Buffer</td>
 +
                            <td>10</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">DMSO</td>
 +
                            <td>4</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">dNTP</td>
 +
                            <td>4</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">Forward Primer</td>
 +
                            <td>2</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">Reverse Primer</td>
 +
                            <td>2</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">Targeted DNA fragment</td>
 +
                            <td>1</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">phusion</td>
 +
                            <td>1</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">ddH<sub>2</sub>O</td>
 +
                            <td>26</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">In Total</td>
 +
                            <td>50</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>95℃ for 10min</td>
 +
                            <td></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>95℃ for 15s</td>
 +
                            <td>n cycles</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>n℃ for 60s</td>
 +
                            <td></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>4℃ reserved</td>
 +
                            <td></td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
                <h4>2. Then, we checked the result of PCR through agarose gel electrophoresis（1% agarose gel；110V for 30min）</h4>
 +
                <h4>3. We cut the fragments of gel and performed purification </h4>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th colspan="2">PCR production purification</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">PE Buffer</td>
 +
                            <td>750μl/per column</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">PB Buffer</td>
 +
                            <td>50μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">Elution Buffer</td>
 +
                            <td>30μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th>Gel recycling</th>
 +
                            <th></th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">PE Buffer</td>
 +
                            <td>600μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">EB Buffer</td>
 +
                            <td>50μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
                <h4>Finally, we got the amplified products of miR-141-BS and miR-148b-BS and made them stored at -20℃</h4>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="June7">
 +
                <h2>June 7</h2>
 +
                <h4>1.We digested the two binding sites with the same incision enzyme with the vector (LSBr5and3), then we connected BS and vector together.</h4>
 +
                <table class="table table-striped table-inverse table-sm table-responsive table-secondary">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td class="row"><b>Digestion</b></td>
 +
                            <td>DNA </td>
 +
                            <td>Vector</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">In Total</td>
 +
                            <td>10</td>
 +
                            <td>15</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">Kpn11</td>
 +
                            <td>1</td>
 +
                            <td>1</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">Xho1</td>
 +
                            <td>1</td>
 +
                            <td>1</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XBuffer</td>
 +
                            <td>2</td>
 +
                            <td>2</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">ddH<sub>2</sub>O</td>
 +
                            <td>6</td>
 +
                            <td>11</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2"><b>Connection</b></td>
 +
                            <td>Volume</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2">Fragment</td>
 +
                            <td>3μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2">Vector</td>
 +
                            <td>10μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2">10XBuffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2">T<sub>4</sub> DNA Ligase</td>
 +
                            <td>3μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2">ddH<sub>2</sub>O</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row" colspan="2">Total</td>
 +
                            <td>20μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
                <h4>2.We got the recombined plasmids to translate them to the competent E.coli cells</h4>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">PGL4.22-Promoter</td>
 +
                                <td>0ng</td>
 +
                                <td>5 ng</td>
 +
                                <td>10 ng</td>
 +
                                <td>20 ng</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">β-Gal(line lacZ)</td>
 +
                                <td>10ng</td>
 +
                                <td>10 ng</td>
 +
                                <td>10 ng</td>
 +
                                <td>10 ng</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Empty </td>
 +
                                <td>90 ng</td>
 +
                                <td>85 ng</td>
 +
                                <td>80 ng</td>
 +
                                <td>70 ng</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row" colspan="5">The total plasmid DNA content of each hole (12 holes in total) in the 24-well plate was 100ng.According to the Lipomax: DNA = 3 mu l;The 100ng ratio is configured with the following optin mixture</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">+25μl Optin-DNA</td>
 +
                                <td colspan="4">Incubate 5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">+25μl Optin-Lipomax</td>
 +
                                <td colspan="4">incubate5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row" colspan="5">Blend, then incubate for 20min（the system has a total of 50μl）</td>
 +
                            </tr>
 +
                        </tbody>
 +
                </table>
 +
                <h4>3.We cultured the bacteria cells with concussion for 12h</h4>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="June8">
 +
                <h2>June 8</h2>
 +
                <p>We transferred the bacteria cells to the solid LB medium with Amp<sup>+</sup></p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td class="row" colspan="2">Solid LB medium with Amp<sup>+</sup></td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">LB medium （liquid）</td>
 +
                            <td>3.96ml</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">Amp</td>
 +
                            <td>4μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="June9">
 +
                <h2>June 9</h2>
 +
                <p>We picked up the AmpR+ cells and put miRNA mimics of miR-141 and miR-148b to the liquid medium</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="June10">
 +
                <h2>June 10</h2>
 +
                <p>We took these cells for FACS gauging and observed the rate of different colors expressed by cells</p>
 +
            </div>
 +
           
 +
            <!-- 7 -->
 +
            <div class="col-md-12" id="July">
 +
                <h2>July</h2>
 +
                <h3>Main Tasks</h3>
 +
                <h4>July 13-24</h4>
 +
                <p>Construction of Sponge and gauging efficiency of Sponge</p>
 +
                <h4>July 25-30</h4>
 +
                <p>Construction of Synthetic Promoter and gauging efficiency of promoter (Partly, the rest was done in August)</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July13">
 +
                <h2>July 13</h2>
 +
                <p>We purchased the primer of sponge of two miRNA: miR-141 and miR-148b</p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full">
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th>Items</th>
 +
                                <th>Sequence(5’→3’)</th>
 +
                            </tr>
 +
                            </thead>
 +
                            <tbody>
 +
                                <tr>
 +
                                    <td scope="row">F-miR-141-sponge</td>
 +
                                    <td>CGTCTCCAGCCGTAGAAGGA</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row">R-miR-141-sponge</td>
 +
                                    <td>CGTCTCCCGAGCATCTTCCT</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row">F-miR-148b-sponge</td>
 +
                                    <td>CGTCTCCAGCCACAAAGTTG</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row">R-miR-148b-sponge</td>
 +
                                    <td>CGTCTCCCGAGTCAGTGCAT</td>
 +
                                </tr>
 +
                            </tbody>
 +
                    </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July15">
 +
                <h2>July 15</h2>
 +
                <p>We got the primer and took up for PCR amplification</p>
 +
                <table class="table table-striped table-inverse table-sm table-responsive table-secondary">
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th>Reagent</th>
 +
                                <th>Volume(μl)</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">5X Buffer</td>
 +
                                <td>10</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">DMSO</td>
 +
                                <td>4</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">dNTP</td>
 +
                                <td>4</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Forward Primer</td>
 +
                                <td>2</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Reverse Primer</td>
 +
                                <td>2</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">Targeted DNA fragment</td>
 +
                                <td>1</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">phusion</td>
 +
                                <td>1</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">ddH<sub>2</sub>O</td>
 +
                                <td>26</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">In Total</td>
 +
                                <td>50</td>
 +
                            </tr>
 +
                        </tbody>
 +
                    </table>
 +
                    <p>Then put the reaction system to the PCR machine</p>
 +
                    <table class="table table-inverse table-sm table-responsive table-secondary">
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th>Cycle</th>
 +
                                <th>Temperature</th>
 +
                                <th>Time</th>
 +
                            </tr>
 +
                            </thead>
 +
                            <tbody>
 +
                                <tr>
 +
                                    <td scope="row"></td>
 +
                                    <td>94℃</td>
 +
                                    <td>5min</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row" rowspan="3">10 cycles Add 0.5℃ after per cycle</td>
 +
                                    <td>94℃</td>
 +
                                    <td>30s</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td>55℃</td>
 +
                                    <td>30s</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td>72℃</td>
 +
                                    <td>30s</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row" rowspan="3">25 cycles</td>
 +
                                    <td>94℃</td>
 +
                                    <td>30s</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td>60℃</td>
 +
                                    <td>30s</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td>72℃</td>
 +
                                    <td>30s</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row"></td>
 +
                                    <td>72℃</td>
 +
                                    <td>7min</td>
 +
                                </tr>
 +
                                <tr>
 +
                                    <td scope="row"></td>
 +
                                    <td>4℃</td>
 +
                                    <td>reserved</td>
 +
                                </tr>
 +
                            </tbody>
 +
                    </table>
 +
                <p>We took the products for agarose gel electrophoresis</p>
 +
                <p>We cut the fragments of gel and performed purification </p>
 +
                <p>Finally, we got the amplified products of Sponge-miR-141 and Sponge-miR-148b and stored at -20℃</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July16">
 +
                <h2>July 16</h2>
 +
                <p>We chose to construct the plasmid pEGFP-N1-sponge141_148b. Through double digestion towards the plasmid and the two Sponge, we made them connected and translated them to the competent E.coli cells</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July16">
 +
                <h2>July 17</h2>
 +
                <p>We gauged the efficiency of Sponge expression through luciferase assay </p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July25">
 +
                <h2>July 25</h2>
 +
                <p>We designed the primer of the three synthetic promoters used for three Modules</p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary table-striped table-full">
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">F-ESR1-EcoRI</td>
 +
                                <td>CCGGAATTCATGACCATGACCCTCCAC</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">R-ESR1-BamHI</td>
 +
                                <td>CGCGGATCCTCAGACCGTGGCAGGGAA</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">F-GATA3-EcoRI</td>
 +
                                <td>CCGGAATTCATGGAGGTGACGGCGGAC</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">R-GATA3-BamHI</td>
 +
                                <td>CGCGGATCCCTAACCCATGGCGGTGAC</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">R-G8p-XhoI</td>
 +
                                <td>CCGCTCGAGTTTACCAACAGTACCGGA</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">R-lateADEp-XhoI</td>
 +
                                <td>CCGCTCGAGAGAGTGAGGACGAACGCC</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">F-G8p-SacI</td>
 +
                                <td>CGAGCTCCGATAGGTACCGAGTTTC</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">F-G8p-KpnI</td>
 +
                                <td>CGGGGTACCCGATAGGTACCGAGTTTC</td>
 +
                            </tr>
 +
                        </tbody>
 +
                    </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July28">
 +
                <h2>July 28</h2>
 +
                <p>We designed the structure of s(GATA3)p for Module1 </p>
 +
                <p>Plasmid: PGL4.22-s(GATA3)p</p>     
 +
                <img src="https://static.igem.org/mediawiki/2019/4/48/T--CSU_CHINA--LabT5P2F5.1.1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="July30">
 +
                <h2>July 30</h2>
 +
                <p>We designed the structure of s(GATA3)p for Module1 </p>
 +
                <p>Plasmid: PGL4.22-s(GATA3)p</p>     
 +
                <img src="https://static.igem.org/mediawiki/2019/f/f4/T--CSU_CHINA--LabT5P2F5.2.1.png" alt="">
 +
            </div>
 +
 
 +
            <!-- 8 -->
 +
            <div class="col-md-12" id="August">
 +
                <h2>August</h2>
 +
                <h3>Main Tasks</h3>
 +
                <h4>August 6-20</h4>
 +
                <p>Golden Gate method for connection</p>
 +
                <h4>August 24-30</h4>
 +
                <p>Construction of Module1</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August2">
 +
                <h2>August 2</h2>
 +
                <p>We designed the structure of s(ESR1)p for Module3</p>
 +
                <p>Plasmid: pGL4.22-G8p</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/0/09/T--CSU_CHINA--LabT5P2F5.3.1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August5">
 +
                <h2>August 5</h2>
 +
                <p>We tested the efficiency of promoters.</p>
 +
                <p>Plasmid: pGL4.22-hTERT</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/b/b0/T--CSU_CHINA--LabT5P6F5.6.2.png" alt="">
 +
                <img src="https://static.igem.org/mediawiki/2019/f/f4/T--CSU_CHINA--LabT5P2F5.2.1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August6">
 +
                <h2>August 6</h2>
 +
                <p>We utilized Golden gate method to connect Module1 and Module2</p>
 +
                <p>Plasmid: pEGFP-N1-lacZ</p>
 +
                <img src=" https://static.igem.org/mediawiki/2019/c/c3/T--CSU_CHINA--LabT6P3F6.3.1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August8">
 +
                <h2>August 8</h2>
 +
                <p>We constructed the plasmid for Module1</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/9/94/T--CSU_CHINA--LabT6P3F6.3.4.1.png" alt="">
 +
                <img src="https://static.igem.org/mediawiki/2019/f/f4/T--CSU_CHINA--LabT5P2F5.2.1.png" alt="">
 +
                <img src="https://static.igem.org/mediawiki/2019/8/89/T--CSU_CHINA--LabT6P1F6.1.1.png" alt="">
 +
                <img src="https://static.igem.org/mediawiki/2019/5/55/T--CSU_CHINA--LabT6P2F6.2.2.png" alt="">
 +
                <p>Promoter region: BsmBI RS-s(GATA3)p-BsmBI RS; screening and identification region: BsmBI RS-lacZp-lacZ-BsmBI RS</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August8">
 +
                <h2>August 11</h2>
 +
                <p>We constructed pLN431-s(GATA3)p</p>
 +
                <p>Golden gate method to connect the elements  </p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary table-striped">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td class="row">pLN431 plasmid</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">s(GATA3)p</td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XT<sub>4</sub> Ligase Buffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XBuffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">BsmBI </td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">ddH<sub>2</sub>O</td>
 +
                            <td>12l</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">Total</td>
 +
                            <td>20μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
                <p>Then, we amplified them by PCR</p>
 +
                <table class="table table-striped table-sm table-inverse table-responsive table-secondary" >
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th colspan="2">Step 1(X10)</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">37℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">16℃</td>
 +
                                <td>10min</td>
 +
                            </tr>
 +
                        </tbody>
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th colspan="2">Step 2</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">37℃</td>
 +
                                <td>15min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">50℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">80℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                        </tbody>
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th colspan="2">Step 3</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">16℃</td>
 +
                                <td>reserved</td>
 +
                            </tr>
 +
                        </tbody>
 +
                    </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August12">
 +
                <h2>August 12</h2>
 +
                <p>We constructed the plasmid for Module2</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/d/d3/T--CSU_CHINA--LabT6P2F6.2.1.jpg" alt="">
 +
                <img src="https://static.igem.org/mediawiki/2019/4/48/T--CSU_CHINA--LabT5P2F5.1.1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August16">
 +
                <h2>August 16</h2>
 +
                <h4>1. pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b) </h4>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary table-striped">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td class="row">Vector</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">miR141-Sponge</td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">s(ESR1)p</td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XT4 Ligase Buffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XBuffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">BsmBI</td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">ddH<sub>2</sub>O</td>
 +
                            <td>11μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">Total</td>
 +
                            <td>20μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
                <h4>2. pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141) </h4>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary table-striped">
 +
                        <tbody>
 +
                            <tr>
 +
                                <td class="row">Vector</td>
 +
                                <td>2μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">miR141-Sponge</td>
 +
                                <td>1μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">s(ESR1)p</td>
 +
                                <td>1μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">10XT4 Ligase Buffer</td>
 +
                                <td>2μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">10XBuffer</td>
 +
                                <td>2μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">BsmBI</td>
 +
                                <td>1μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">ddH<sub>2</sub>O</td>
 +
                                <td>11μl</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td class="row">Total</td>
 +
                                <td>20μl</td>
 +
                            </tr>
 +
                        </tbody>
 +
                </table>
 +
                <h4>3.PCR amplification</h4>
 +
                <table class="table table-striped table-sm table-inverse table-responsive table-secondary" >
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th colspan="2">Step 1(X10)</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">37℃</td>
 +
                            <td>5min</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">16℃</td>
 +
                            <td>10min</td>
 +
                        </tr>
 +
                    </tbody>
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th colspan="2">Step 2</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">37℃</td>
 +
                            <td>15min</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">50℃</td>
 +
                            <td>5min</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">80℃</td>
 +
                            <td>5min</td>
 +
                        </tr>
 +
                    </tbody>
 +
                    <thead class="thead-inverse">
 +
                        <tr>
 +
                            <th colspan="2">Step 3</th>
 +
                        </tr>
 +
                    </thead>
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">16℃</td>
 +
                            <td>reserved</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August20">
 +
                <h2>August 20</h2>
 +
                <p>We tested the construction of Plasmid and important elements via gel electrophoresis</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/2/2d/T--CSU_CHINA--LabT6P4F6.4.1.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August24">
 +
                <h2>August 24</h2>
 +
                <p>We got the sequences of elements of Module1</p>
 +
                <p>Here is the sequence of GAD</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/1/13/T--CSU_CHINA--LabT7P1F7.1.3.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="August25">
 +
                <h2>August 25</h2>
 +
                <p>We turned to golden gate method to connect all the elements of Module1</p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary table-striped">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td class="row">pLN431 plasmid</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">s(GATA3)p</td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XT<sub>4</sub> Ligase Buffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">10XBuffer</td>
 +
                            <td>2μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">BsmBI </td>
 +
                            <td>1μl</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">ddH<sub>2</sub>O</td>
 +
                            <td>12l</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td class="row">Total</td>
 +
                            <td>20μl</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
                <p> Then, we amplified them by PCR</p>
 +
                <table class="table table-striped table-sm table-inverse table-responsive table-secondary" >
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th colspan="2">Step 1(X10)</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">37℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">16℃</td>
 +
                                <td>10min</td>
 +
                            </tr>
 +
                        </tbody>
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th colspan="2">Step 2</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">37℃</td>
 +
                                <td>15min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">50℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                            <tr>
 +
                                <td scope="row">80℃</td>
 +
                                <td>5min</td>
 +
                            </tr>
 +
                        </tbody>
 +
                        <thead class="thead-inverse">
 +
                            <tr>
 +
                                <th colspan="2">Step 3</th>
 +
                            </tr>
 +
                        </thead>
 +
                        <tbody>
 +
                            <tr>
 +
                                <td scope="row">16℃</td>
 +
                                <td>reserved</td>
 +
                            </tr>
 +
                        </tbody>
 +
                </table>
 +
                <img src="https://static.igem.org/mediawiki/2019/9/95/T--CSU_CHINA--LabT7P1F7.1.1.png" alt="">
 +
                <img src="https://static.igem.org/mediawiki/2019/d/de/T--CSU_CHINA--LabT7P1F7.1.2.png" alt="">
 +
            </div>
 +
 
 +
            <!-- 9 -->
 +
            <div class="col-md-12" id="September">
 +
                    <h2>September</h2>
 +
                    <h3>Main tasks</h3>
 +
                    <h4>September 2-11</h4>
 +
                    <p>Construction of Module3</p>
 +
                    <h4>September 13-20</h4>
 +
                    <p>Construction of Module2</p>
 +
                    <h4>September 21-29</h4>
 +
                    <p>III. Transfection with Transferrin modified liposome</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September2">
 +
                <h2>September 2</h2>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row">R-G8p-XhoI</td>
 +
                            <td>CCGCTCGAGTTTACCAACAGTACCGGA</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>R-lateADEp-XhoI</td>
 +
                            <td>CCGCTCGAGAGAGTGAGGACGAACGCC</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">SF-G8p-SacI</td>
 +
                            <td>CGAGCTCCGATAGGTACCGAGTTTC</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">F-G8p-KpnI</td>
 +
                            <td>CGGGGTACCCGATAGGTACCGAGTTTC</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September5">
 +
                <h2>September 5</h2>
 +
                <p>Basic parts connecting</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/b/b0/T--CSU_CHINA--LabT9P2F9.2.1.png" alt="">
 +
                <p>yCD</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/e/e6/T--CSU_CHINA--LabT9P2F9.2.3.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September9">
 +
                <h2>September 9</h2>
 +
                <p>We constructed pLN431-G8p-yCD-(miR-BS)</p>
 +
                <img src=" https://static.igem.org/mediawiki/2019/9/9d/T--CSU_CHINA--LabT9P2F9.2.4.png" alt="">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September11">
 +
                <h2>September 11</h2>
 +
                <p>We translated the plasmid to E.coli and transferred them to Amp+ solid medium , then picked the single bacterial colony for sequencing whether the plasmid was constructed correctly</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September13">
 +
                <h2>September 13</h2>
 +
                <p>We connected the elements of Module2 with Golden gate method and amplified.</p>
 +
                <p>1.Basic plasmid: pEGFP-N1-LacZ</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/c/c3/T--CSU_CHINA--LabT6P3F6.3.1.png" alt="">
 +
                <p>2.Elements of Module2</p>
 +
                <p>PEGFP-N1- LacZ-s(ESR1)p Sponge</p>
 +
                <p>3.Connection by Golden gate method and constructing the whole Module2</p>
 +
                <p>We constructed pEGFP-N1-LacZ-miR148b-sponge; pEGFP-N1-LacZ-miR141-sponge; pEGFP-N1-LacZ-miR101-sponge</p>
 +
                <p>4.Amplification of Module2</p>
 +
                <table class="table table-sm table-inverse table-responsive table-secondary">
 +
                    <tbody>
 +
                        <tr>
 +
                            <td scope="row" >F-s(ESR1)p-BsmBI</td>
 +
                            <td>GCCATCGTCTCCACTGAGGTCACGGTGACCT</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td>R-s(ESR1)p-BsmBI</td>
 +
                            <td>CGATTCGTCTCCGGCTAGAGTGAGGACGAA</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">F-miR141spe-EcoRI</td>
 +
                            <td>CCGGAATTCGCCGTAGAAGGAATGTCA</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">R-miR141spe-BamHI</td>
 +
                            <td>CGCGGATCCGAGCATCTTCCTTACAGT</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">F-miR148bspe-EcoRI</td>
 +
                            <td>CCGGAATTCGCCACAAAGTTGTGAAAT</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">R-miR148bspe-BamHI</td>
 +
                            <td>CGCGGATCCGAGTCAGTGCATTTCA</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">F-s(ESR1)p-KpnI</td>
 +
                            <td>CGGGGTACCAGGTCACGGTGACCTTCT</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">Sponge-141-BsmBI</td>
 +
                            <td>CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG</td>
 +
                        </tr>
 +
                        <tr>
 +
                            <td scope="row">Sponge-148b-BsmBI</td>
 +
                            <td>CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG</td>
 +
                        </tr>
 +
                    </tbody>
 +
                </table>     
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September15">
 +
                <h2>September 15</h2>
 +
                <p>We translated the plasmid to E.coli and transferred them to Amp+ solid medium , then picked the single bacterial colony for sequencing whether the plasmid was constructed correctly</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September20">
 +
                <h2>September 20</h2>
 +
                <p>We tested when Module1+Module3 to examine whether G8p can be expressed.</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/e/e0/T--CSU_CHINA--LabT9P3F9.3.1.png">
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September21">
 +
                <h2>September 21</h2>
 +
                <p>We utilized the plasmid of Module1 2 3 for co-transfecting</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September24">
 +
                <h2>September 24</h2>
 +
                <img src="https://static.igem.org/mediawiki/2019/5/52/T--CSU_CHINA--LabT11P2F11.2.1.png">
 +
                <p>HBL-100 with TF-NC for Day1</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/d/d0/T--CSU_CHINA--LabT11P2F11.2.2.png">
 +
                <p>HBL-100 with TF-p53 for Day1</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/8/8f/T--CSU_CHINA--LabT11P2F11.2.3.png">
 +
                <p>MDA-MB-231 with TF-NC for Day1</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/b/b9/T--CSU_CHINA--LabT11P2F11.2.4.png">
 +
                <p>MDA-MB-231 with TF-p53 for Day1</p>       
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="September25">
 +
                <h2>September 2</h2>
 +
                <img src="https://static.igem.org/mediawiki/2019/0/06/T--CSU_CHINA--LabT11P2F11.2.5.png">
 +
                <p>HBL- 100 with TF-NC for Day2</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/7/77/T--CSU_CHINA--LabT11P2F11.2.6.png">
 +
                <p>HBL- 100 with TF-p53 for Day2</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/5/5f/T--CSU_CHINA--LabT11P2F11.2.7.png">
 +
                <p>MDA-MB-231 with TF-NC for Day2</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/b/b0/T--CSU_CHINA--LabT11P2F11.2.8.png">
 +
                <p>MDA-MB-231 with TF-p53 for Day2</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/4/4d/T--CSU_CHINA--DSept25.5.png">
 +
                <p>DAPI Staining of MDA-MB-231 with TF-P53 For Day1</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/c/ce/T--CSU_CHINA--DSeptember25.6.png">
 +
                <p>DAPI Staining of MDA-MB-231 with TF-P53 For Day2</p>       
 +
            </div>
 +
 
 +
            <!-- 10 -->
 +
            <div class="col-md-12" id="October">
 +
                <h2>October</h2>
 +
                <h3>Main Tasks</h3>
 +
                <h4>October 8-10</h4>
 +
                <p>DAPI staining</p>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="October8">
 +
                <h2>October 8</h2>
 +
                <p>We used DAPI staining method to observe the system that transfected to MBA-MD-231 and HBL-100 for one day to test whether it worked.</p>
 +
                <h4>1.We prepared the two cell lines with transfecting the whole circuit, then operated as followed</h4>
 +
                <ol>
 +
                    <li>Wash the media with PBS for three times</li>
 +
                    <li>Incubate with PFA for 30-60 minutes</li>
 +
                    <li>Wash the media with PBS for three times</li>
 +
                    <li>Incubate in a solution of 1µg/ml 4,6-diamidino-2-phenylindole (DAPI) for 30 minutes</li>
 +
                    <li>Count cells under fluorescence microscope</li>
 +
                </ol>
 +
                <h4>2.Results</h4>
 +
                <img src="https://static.igem.org/mediawiki/2019/f/f4/T--CSU_CHINA--NOctober8.1.png" alt="">
 +
                <h5>Fig.1 HBL-100 transfected with liposome for Day1</h5>
 +
                <img src="https://static.igem.org/mediawiki/2019/5/53/T--CSU_CHINA--NOctober8.2.png" alt="">
 +
                <h5>Fig.2 MDA-MB-231 transfected with liposome for Day1</h5>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="October9">
 +
                <h2>October 9</h2>
 +
                <p>We left the same cells as Octo.8 after being transfected for the two days , here were the results.</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/a/a3/T--CSU_CHINA--NOct9.1.png" alt="">
 +
                <h5>Fig.3 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day2</h5>
 +
                <img src="https://static.igem.org/mediawiki/2019/4/40/T--CSU_CHINA--NOct9.2.png" alt="">
 +
                <h5>Fig.4 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day2</h5>
 +
            </div>
 +
 
 +
            <div class="col-md-12" id="October10">
 +
                <h2>October 10</h2>
 +
                <p>We left the same cells as Oct.8 after being transfected for the three days , then we observed obvious results differentially in TNBC cells and normal cells.</p>
 +
                <img src="https://static.igem.org/mediawiki/2019/8/86/T--CSU_CHINA--OCT10.1.png" alt="">
 +
                <h5>Fig.5 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day 3</h5>
 +
                <img src="https://static.igem.org/mediawiki/2019/0/03/T--CSU_CHINA--NOct10.2.png" alt="">
 +
                <h5>Fig.6 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day3</h5>
 +
                <p>Comparing Day2 and Day3, we noticed that the whole system transfected to MDA-MB-231 cells successfully worked and killed TNBC cells efficiently and specifically. </p>
 +
            </div>
 +
        </div>
 +
    </div>
 +
   
 +
    <script>
 +
        $(document).ready(function(){
 +
            //数据
 +
            var month_normal = [31,28,31,30,31,30,31,31,30,31,30,31];
 +
            var month_name = ["January","Febrary","March","April","May","June","July","Auguest","September","October","November","December"];
 +
            var wdata = [  ["13","16","17","22","25","27","29"],//May
 +
                            ["3","6","7","8","9","10"],//June
 +
                            ["13","15","16","24","25","28","30"],//July
 +
                            ["2","5","6","8","11","12","16","20"],//Auguest
 +
                            ["2","5","9","11","13","15","20","21","24","25"],//September
 +
                            ["8","9","10"]//October
 +
                        ];
 +
            //根据年月获取当月第一天是周几
 +
            function dayStart(month){
 +
                var tmpDate = new Date(2019, month, 1);
 +
                return (tmpDate.getDay());
 +
            };
 +
            //数据加载
 +
            function refreshDate(my_month){
 +
                var obj = new Array;
 +
                //计算当月的天数和每月第一天都是周几
 +
                var firstDay = dayStart(my_month);
 +
                //添加每个月的空白部分
 +
                for(var i = 0; i < firstDay; i++) obj.push("");
 +
                //每月的日子
 +
                for(var i = 1; i <= month_normal[my_month]; i++) obj.push(i.toString());
 +
                //清空
 +
                $("#cal-body").empty();
 +
                //加载
 +
                $("#cal-month").text(month_name[my_month]);
 +
                //数据
 +
                $("#cal-body").append("<tr>");
 +
                var i=0;
 +
                for(; i<obj.length; i++ ){
 +
                    $("#cal-body").append("<td>"+obj[i]+"</td>");
 +
                    if(i%7==6) $("#cal-body").append("</tr><tr>");
 +
                };
 +
                //填空
 +
                var l = 7-i%7;
 +
                for(var j=0; j<l; j++) $("#cal-body").append("<td></td>");
 +
                $("#cal-body").append("</tr>");
 +
                //加载样式
 +
                $("#cal-body").children().each(function(){
 +
                    if($.inArray($(this).text(),wdata[my_month-4])==-1)
 +
                        $(this).addClass("text-muted");
 +
                    else
 +
                        $(this).addClass("text-danger");
 +
                });
 +
                //激活样式
 +
                $("#cal-body").find(".text-danger").first().addClass("table-info");
 +
            };
 +
            //初始化
 +
            refreshDate($("#cal-month").data("month"));
 +
            //向前
 +
            $("#pre").click(function(){
 +
                var m = $("#cal-month").data("month");
 +
                if(m > 4){
 +
                    $("#cal-month").data("month", m-1);
 +
                    refreshDate(m-1);
 +
                }
 +
            });
 +
            //向后
 +
            $("#next").click(function(){
 +
                var m = $("#cal-month").data("month");
 +
                if(m < 9){
 +
                    $("#cal-month").data("month", m+1);
 +
                    refreshDate(m+1);
 +
                }
 +
            });
 +
            //点击
 +
            $("#cal-body .text-danger").click(function(){
 +
                $("#cal-body .table-info").removeClass("table-info");
 +
                $(this).addClass("table-info");
 +
                var linkday = "#"+$("#cal-month").text() + $(this).text();
 +
                window.location.href = linkday;
 +
            });
 +
        });
 +
    </script>
 +
   
 +
 
 +
 
 +
</body>
  
 
</html>
 
</html>

Revision as of 03:29, 22 October 2019

loading……

Notebook

NOTEBOOK

May

Main tasks

May 13-25

Screening TNBC specific Transcription factors (TFs)

May 27-29

Screening of low-expressed miRNA in TNBC

May 13

We screened for high-expressed genes in tumor groups in all invasive breast cancer from GEPIA database. Then, 245 genes is selected initially. 86 normal breast transcriptome samples and 303 tumor transcriptome samples were downloaded from TCGA (The Cancer Genome Atlas) database. The differentially expressed genes were screened by EdgeR algorithm. And all genes were selected in the GEPIA results set (245).

1.2.May 16

We used the GEPIA database to test the most specific differential-expressed gene in invasive breast cancer, and found out that 11 overlaps with the previously selected 245. Following the priority order for transcription factor identification, 9 transcription factors were identified.

May 21

Today we designed the primer of 9 TFs for PCR, and verified the expression of 9 selected TFs with qPCR.

May 22

Through RT reaction of mRNA and qPCR towards the cDNA, we got the results of qPCR. According to the expression in TNBC cell lines and normal cell lines, We chose ESR1 and GATA3 to design synthetic promoters.

May 25

We checked the potential specific miRNA in TNBC cells from articles and verified from TGCA database, then we purchased the primers of these miRNAs and amplified them The miRNAs we chose: miR-148b , miR-591, miR-125b, miR-34c-3p, miR-26a/26b, miR-216b, miR-101, miR-340, miR-409-3p, miR-489, miR-141, miR146a, miR-542-3p, miR-135a

May 27

1.We performed reverse transcription on miRNA and got these cDNA

    Combine 3μl of 5X RT Primer and 5 μl of double-stranded template in a reaction tube. Mix thoroughly, then centrifuge briefly to collect the contents at the bottom of the tube. Incubate at 85℃ for 5min Incubate at 60℃ for 5min, then place on ice Add 7μl of RT Reaction Mix to each reaction tube. (details from “Preparing for RT Reaction Mix” showed above) Centrifuge briefly to collect the contents at the bottom of the tubes
Step Temperature Time
Reverse transcription 16℃ 30min
42℃ 30min
Stop reaction 85℃ 5min
Hold 4℃ Hold

2.Then we utilized these cDNA for qPCR

SYBR 5μl
F Primer 0.2μl
R Primer 0.2μl
ddH2O 2.6μl
cDNA 2μl
Total 10μl
Then put them for qPCR machine
95℃ for 10min
95℃ for 15s 40 cycles
60℃ for 60s
4℃ reserved

3.Result

May 29

We chose the specifically high-expressed miRNA: miR-148b and miR-141 for qPCR, and the result was showed below.

June

Main Tasks

June 3-10

Construction and examination of Binding Sites

June 3

We purchased the service of synthesizing the whole sequence for binding sites of miR-141 and miR-148b(then got the miR-141-BS and miR-148b-BS) from Sangon Biotech.

Items Sequence ( 5‘→3’) Length
miR-141-BS ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA 106
miR-148b-BS ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA 110

June 6

1. We took the synthetic sequence(miR-141-BS and miR-148b-BS) for PCR amplification

Reagent Volume(μl)
5X Buffer 10
DMSO 4
dNTP 4
Forward Primer 2
Reverse Primer 2
Targeted DNA fragment 1
phusion 1
ddH2O 26
In Total 50
95℃ for 10min
95℃ for 15s n cycles
n℃ for 60s
4℃ reserved

2. Then, we checked the result of PCR through agarose gel electrophoresis（1% agarose gel；110V for 30min）

3. We cut the fragments of gel and performed purification

PCR production purification
PE Buffer 750μl/per column
PB Buffer 50μl
Elution Buffer 30μl
Gel recycling
PE Buffer 600μl
EB Buffer 50μl

Finally, we got the amplified products of miR-141-BS and miR-148b-BS and made them stored at -20℃

June 7

1.We digested the two binding sites with the same incision enzyme with the vector (LSBr5and3), then we connected BS and vector together.

Digestion DNA Vector
In Total 10 15
Kpn11 1 1
Xho1 1 1
10XBuffer 2 2
ddH2O 6 11
Connection Volume
Fragment 3μl
Vector 10μl
10XBuffer 2μl
T4 DNA Ligase 3μl
ddH2O 2μl
Total 20μl

2.We got the recombined plasmids to translate them to the competent E.coli cells

PGL4.22-Promoter 0ng 5 ng 10 ng 20 ng
β-Gal(line lacZ) 10ng 10 ng 10 ng 10 ng
Empty 90 ng 85 ng 80 ng 70 ng
The total plasmid DNA content of each hole (12 holes in total) in the 24-well plate was 100ng.According to the Lipomax: DNA = 3 mu l;The 100ng ratio is configured with the following optin mixture
+25μl Optin-DNA Incubate 5min
+25μl Optin-Lipomax incubate5min
Blend, then incubate for 20min（the system has a total of 50μl）

3.We cultured the bacteria cells with concussion for 12h

June 8

We transferred the bacteria cells to the solid LB medium with Amp+

Solid LB medium with Amp+
LB medium （liquid） 3.96ml
Amp 4μl

June 9

We picked up the AmpR+ cells and put miRNA mimics of miR-141 and miR-148b to the liquid medium

June 10

We took these cells for FACS gauging and observed the rate of different colors expressed by cells

July

Main Tasks

July 13-24

Construction of Sponge and gauging efficiency of Sponge

July 25-30

Construction of Synthetic Promoter and gauging efficiency of promoter (Partly, the rest was done in August)

July 13

We purchased the primer of sponge of two miRNA: miR-141 and miR-148b

Items Sequence(5’→3’)
F-miR-141-sponge CGTCTCCAGCCGTAGAAGGA
R-miR-141-sponge CGTCTCCCGAGCATCTTCCT
F-miR-148b-sponge CGTCTCCAGCCACAAAGTTG
R-miR-148b-sponge CGTCTCCCGAGTCAGTGCAT

July 15

We got the primer and took up for PCR amplification

Reagent Volume(μl)
5X Buffer 10
DMSO 4
dNTP 4
Forward Primer 2
Reverse Primer 2
Targeted DNA fragment 1
phusion 1
ddH2O 26
In Total 50

Then put the reaction system to the PCR machine

Cycle Temperature Time
94℃ 5min
10 cycles Add 0.5℃ after per cycle 94℃ 30s
55℃ 30s
72℃ 30s
25 cycles 94℃ 30s
60℃ 30s
72℃ 30s
72℃ 7min
4℃ reserved

We took the products for agarose gel electrophoresis

We cut the fragments of gel and performed purification

Finally, we got the amplified products of Sponge-miR-141 and Sponge-miR-148b and stored at -20℃

July 16

We chose to construct the plasmid pEGFP-N1-sponge141_148b. Through double digestion towards the plasmid and the two Sponge, we made them connected and translated them to the competent E.coli cells

July 17

We gauged the efficiency of Sponge expression through luciferase assay

July 25

We designed the primer of the three synthetic promoters used for three Modules

F-ESR1-EcoRI CCGGAATTCATGACCATGACCCTCCAC
R-ESR1-BamHI CGCGGATCCTCAGACCGTGGCAGGGAA
F-GATA3-EcoRI CCGGAATTCATGGAGGTGACGGCGGAC
R-GATA3-BamHI CGCGGATCCCTAACCCATGGCGGTGAC
R-G8p-XhoI CCGCTCGAGTTTACCAACAGTACCGGA
R-lateADEp-XhoI CCGCTCGAGAGAGTGAGGACGAACGCC
F-G8p-SacI CGAGCTCCGATAGGTACCGAGTTTC
F-G8p-KpnI CGGGGTACCCGATAGGTACCGAGTTTC

July 28

We designed the structure of s(GATA3)p for Module1

Plasmid: PGL4.22-s(GATA3)p

July 30

We designed the structure of s(GATA3)p for Module1

Plasmid: PGL4.22-s(GATA3)p

August

Main Tasks

August 6-20

Golden Gate method for connection

August 24-30

Construction of Module1

August 2

We designed the structure of s(ESR1)p for Module3

Plasmid: pGL4.22-G8p

August 5

We tested the efficiency of promoters.

Plasmid: pGL4.22-hTERT

August 6

We utilized Golden gate method to connect Module1 and Module2

Plasmid: pEGFP-N1-lacZ

August 8

We constructed the plasmid for Module1

Promoter region: BsmBI RS-s(GATA3)p-BsmBI RS; screening and identification region: BsmBI RS-lacZp-lacZ-BsmBI RS

August 11

We constructed pLN431-s(GATA3)p

Golden gate method to connect the elements

pLN431 plasmid 2μl
s(GATA3)p 1μl
10XT4 Ligase Buffer 2μl
10XBuffer 2μl
BsmBI 1μl
ddH2O 12l
Total 20μl

Then, we amplified them by PCR

Step 1(X10)
37℃ 5min
16℃ 10min
Step 2
37℃ 15min
50℃ 5min
80℃ 5min
Step 3
16℃ reserved

August 12

We constructed the plasmid for Module2

August 16

1. pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b)

Vector 2μl
miR141-Sponge 1μl
s(ESR1)p 1μl
10XT4 Ligase Buffer 2μl
10XBuffer 2μl
BsmBI 1μl
ddH2O 11μl
Total 20μl

2. pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141)

Vector 2μl
miR141-Sponge 1μl
s(ESR1)p 1μl
10XT4 Ligase Buffer 2μl
10XBuffer 2μl
BsmBI 1μl
ddH2O 11μl
Total 20μl

3.PCR amplification

Step 1(X10)
37℃ 5min
16℃ 10min
Step 2
37℃ 15min
50℃ 5min
80℃ 5min
Step 3
16℃ reserved

August 20

We tested the construction of Plasmid and important elements via gel electrophoresis

August 24

We got the sequences of elements of Module1

Here is the sequence of GAD

August 25

We turned to golden gate method to connect all the elements of Module1

pLN431 plasmid 2μl
s(GATA3)p 1μl
10XT4 Ligase Buffer 2μl
10XBuffer 2μl
BsmBI 1μl
ddH2O 12l
Total 20μl

Then, we amplified them by PCR

Step 1(X10)
37℃ 5min
16℃ 10min
Step 2
37℃ 15min
50℃ 5min
80℃ 5min
Step 3
16℃ reserved

September

Main tasks

September 2-11

Construction of Module3

September 13-20

Construction of Module2

September 21-29

III. Transfection with Transferrin modified liposome

September 2

R-G8p-XhoI CCGCTCGAGTTTACCAACAGTACCGGA
R-lateADEp-XhoI CCGCTCGAGAGAGTGAGGACGAACGCC
SF-G8p-SacI CGAGCTCCGATAGGTACCGAGTTTC
F-G8p-KpnI CGGGGTACCCGATAGGTACCGAGTTTC

September 5

Basic parts connecting

yCD

September 9

We constructed pLN431-G8p-yCD-(miR-BS)

September 11

We translated the plasmid to E.coli and transferred them to Amp+ solid medium , then picked the single bacterial colony for sequencing whether the plasmid was constructed correctly

September 13

We connected the elements of Module2 with Golden gate method and amplified.

1.Basic plasmid: pEGFP-N1-LacZ

2.Elements of Module2

PEGFP-N1- LacZ-s(ESR1)p Sponge

3.Connection by Golden gate method and constructing the whole Module2

We constructed pEGFP-N1-LacZ-miR148b-sponge; pEGFP-N1-LacZ-miR141-sponge; pEGFP-N1-LacZ-miR101-sponge

4.Amplification of Module2

F-s(ESR1)p-BsmBI GCCATCGTCTCCACTGAGGTCACGGTGACCT
R-s(ESR1)p-BsmBI CGATTCGTCTCCGGCTAGAGTGAGGACGAA
F-miR141spe-EcoRI CCGGAATTCGCCGTAGAAGGAATGTCA
R-miR141spe-BamHI CGCGGATCCGAGCATCTTCCTTACAGT
F-miR148bspe-EcoRI CCGGAATTCGCCACAAAGTTGTGAAAT
R-miR148bspe-BamHI CGCGGATCCGAGTCAGTGCATTTCA
F-s(ESR1)p-KpnI CGGGGTACCAGGTCACGGTGACCTTCT
Sponge-141-BsmBI CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG
Sponge-148b-BsmBI CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG

September 15

We translated the plasmid to E.coli and transferred them to Amp+ solid medium , then picked the single bacterial colony for sequencing whether the plasmid was constructed correctly

September 20

We tested when Module1+Module3 to examine whether G8p can be expressed.

September 21

We utilized the plasmid of Module1 2 3 for co-transfecting

September 24

HBL-100 with TF-NC for Day1

HBL-100 with TF-p53 for Day1

MDA-MB-231 with TF-NC for Day1

MDA-MB-231 with TF-p53 for Day1

September 2

HBL- 100 with TF-NC for Day2

HBL- 100 with TF-p53 for Day2

MDA-MB-231 with TF-NC for Day2

MDA-MB-231 with TF-p53 for Day2

DAPI Staining of MDA-MB-231 with TF-P53 For Day1

DAPI Staining of MDA-MB-231 with TF-P53 For Day2

October

Main Tasks

October 8-10

DAPI staining

October 8

We used DAPI staining method to observe the system that transfected to MBA-MD-231 and HBL-100 for one day to test whether it worked.

1.We prepared the two cell lines with transfecting the whole circuit, then operated as followed

  1. Wash the media with PBS for three times
  2. Incubate with PFA for 30-60 minutes
  3. Wash the media with PBS for three times
  4. Incubate in a solution of 1µg/ml 4,6-diamidino-2-phenylindole (DAPI) for 30 minutes
  5. Count cells under fluorescence microscope

2.Results

Fig.1 HBL-100 transfected with liposome for Day1
Fig.2 MDA-MB-231 transfected with liposome for Day1

October 9

We left the same cells as Octo.8 after being transfected for the two days , here were the results.

Fig.3 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day2
Fig.4 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day2

October 10

We left the same cells as Oct.8 after being transfected for the three days , then we observed obvious results differentially in TNBC cells and normal cells.

Fig.5 HBL-100 cell line with DAPI Staining under fluorescent microscope for Day 3
Fig.6 MDA-MB-231 cell line with DAPI Staining under fluorescent microscope for Day3

Comparing Day2 and Day3, we noticed that the whole system transfected to MDA-MB-231 cells successfully worked and killed TNBC cells efficiently and specifically.