LAB TASKS

Task One: Screening TNBC specific Transcription factors (TFs)

May 13-25

We get our idea that we can design synthetic promoters to initiate every Modules by receiving the activation of the TFs specifically expressed in human Triple Negative Breast Cancer (TNBC) cell lines, then we utilize Bioinformatics methods to screen TFs specifically low expressed in TNBC

Part I

We utilize R (Ver. 3.0.2) to analyze the data from The Cancer Genome Atlas (TCGA) database and turn to GEPIA database to find the differentially expressed TF in TNBC cells.

Then, we consider ESR1 as the best choice and six TFs (E2F1/FOXM1/FOXA1/PITX1/PTTG1/GATA3) for further examination.

Tab.1: Best choice we screen——ESR1

Tab.2: Six TFs we choose to examine further:E2F1/FOXM1/FOXA1/PITX1/PTTG1/GATA3

TCGA					GEPIA ANOVA						GEPIA LIMMA
GENE	logFC	logCPM	PValue	FDR	GENE	FC	P	ID	TUMOR	NORMAL	GENE	FC	P	ID	TUMOR	NORMAL
ESR1	1.665440871	8.646033307	9.29926E-11	3.12438E-10	ESR1	2.636	7.79E-13	ENSG00000091831.21	70.238	10.46	ESR1	2.636	4.11E-23	ENSG00000091831.21	70.238	10.46
E2F1	2.833464601	4.378812917	1.40214E-64	6.6219E-63	E2F1	2.048	9.15E-130	ENSG00000101412.12	9.09	1.44	E2F1	2.048	1.12E-171	ENSG00000101412.12	9.09	1.44
FOXM1	3.633398105	5.396014721	1.31517E-68	7.15612E-67	FOXM1	2.902	1.34E-160	ENSG00000111206.12	17.09	1.42	FOXM1	2.902	2.19E-207	ENSG00000111206.12	17.09	1.42
PITX1	4.362142066	4.915013805	1.64223E-57	5.87336E-56	PITX1	3.49	5.14E-119	ENSG00000069011.15	14.73	0.4	PITX1	3.49	3.25E-173	ENSG00000069011.15	14.73	0.4
PTTG1	3.383676082	4.430763315	3.09255E-78	2.48664E-76	PTTG1	3.255	3.08E-208	ENSG00000164611.12	40.229	3.32	PTTG1	3.255	2.51E-277	ENSG00000164611.12	40.229	3.32
FOXA1	1.89165353	7.877360438	5.0635E-16	2.49821E-15	FOXA1	2.934	1.03E-31	ENSG00000129514.5	158.253	19.84	FOXA1	2.934	1.04E-58	ENSG00000129514.5	158.253	19.84
GATA3-AS1	2.53227903	2.954932901	7.62061E-20	4.79732E-19	GATA3	2.399	3.75E-31	ENSG00000107485.15	251.793	46.921	GATA3	2.399	8.08E-63	ENSG00000107485.15	251.793	46.921

Part II

Through examinations, we choose ESR1 and GATA3 to activate the synthetic promotor for Module 1 and Module 2.

Fig.1: the expression of FOXM1、PTTG1、FOXA1、PITX1 in NC/Tumor lines

Fig.2: the expression of E2F1、GATA3 in NC/Tumor lines

Fig.3: the expression of ESR1 in NC/Tumor lines

Results: According to Fig.1-3, we observe that ESR1 and GATA3 are better differentially expressed TFs between TNBC cells and normal cells, so we utilize ESR1 to activate the synthetic promoter of Module1, and GATA3 of Module2.

Task Two: Screening of miRNA specifically expressed in TNBC

May27-29

According to articles and databases, we choose series of miRNA to examine which are specifically expressed in TNBC

Part I: qPCR for confirming the low expressed miRNA

Through miRNA reverse transcription reaction, we get the cDNA of miRNA and utilize the cDNA to examine the expression via qPCR.

Fig.1: the expression of 12 miRNAs.

Observing the result of qPCR (as Fig.1 showed), we notice that miR-146 and miR-101 are better choices for their low expression in MDA-MB-231 cells comparing to normal cells like HBL-100.

Part II: qPCR for confirming the high expressed but specific miRNA

We notice that some miRNA are specifically high expressed comparing to normal cells, which can be the substrates of their Sponge to lower their expression so that they can be the trigger specifically in TNBC cells. We focused on two miRNA: miR-148b and miR-141, Then we examined their expression, the result was showed as Fig.2.

Fig.2: the specific expression of miR-148b and miR-141;(left)HBL-100,(Right)MDA-MB-231

miR-148b and miR-141 are much higher expressed in TNBC cells comparing to normal cells. Then we can design their Sponge to bind them and lower the expression so as to trigger the initiation of Module1

Result: We finally choose miR-101, miR-146 and so on as low-expressed miRNA specifically in TNBC. Also, we choose miR-141 and miR-148b for the specifically high expression in TNBC cells and modify them for the substrates of Sponge.

Task Three: Design and test of miRNA Binding Site (miR-BS)

June 3-10

Part I: Construction of miR-BS plasmid

Plasmid: LSBr5and3

1. the copy of the whole sequence of miR-BS(Tab.1)
2. PCR of miR-BS
3. Double Digestion on plasmid and miR-BS
4. Connection of plasmid and miR-BS
5. Translate them to E.coli cells

Fig.3.1.1 the structure of miR-141-BS

Fig.3.1.2 the structure of miR-148b-BS

Tab.3.1.11: the complete sequence of miR-BS

Items	Sequence (5’→3’)	Length
miR-141-BS	ATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGCCATTGTGACTAGACCATTTCTAATGGCAA	106
miR-148b-BS	ACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGCCACAAAGTTCTGTGATGCACTGAATGGCAA	110

Part II: Gauging the efficiency of miR-BS: miRNA mimics assey

1. Put miRNA mimics to the E.coli cell medium
2. The report genes on the plasmid will make cell take on different colors since the binding of miR-BS and miRNA after inserting the sequence of miR-BS to the region of mKate2 (transfected unsuccessfully: mKate2+mCherry can express together while transfected successfully, only mCherry can express)
3. FACS gauging, we can get the efficiency of miR-BS by the rate of different colors of cell groups

Fig.3.2.1 the structure of plasmid LSBr5and3

Task Four: Design and test of Sponge

July 13-24

Part I: Sponge Design

Fig 4.1.1: the sequence of Sponge-miR141

Fig 4.1.2: the sequence of Sponge-miR148-b

Part II: the primer of Sponge and PCR amplification

Tab.4.2.1 the sequences or the primers of miR-Sponge

Part III: Gauge the efficiency of expression of the Sponge

Plasmid: pEGFP-N1-sponge141_148b

We transfect the sequence of sponge into the plasmid. 24 hours after transfection, observe the results and record the expression of fluorescent protein.

Part IV : Luciferase assay

We use luciferase reporter assay kits comprising expression vectors that contain the luciferase reporter gene. To perform the reporter assay, we clone the sponge sequence upstream of the luciferase gene in the vectors then introduce that resulting vector DNA into cells, and let the cells grow for a period of time. We then collect the cells, break them open to release all the proteins (including the luciferase), add luciferin and all the necessary cofactors, and measure the enzymatic activity using a luminometer. The luciferase activity can be directly correlated with the activity of the sponge.

Task Five: Synthetic Promoter

July 25-30

Part I: Design of s(ESR1)p

Plasmid: pGL4.22-s(ESR1)p

Fig5.1.1: the structure of s(ESR1)p

Part II: Design of s(GATA3)p

Plasmid: pGL4.22-s(GATA3)p

Fig5.2.1 the structure of s(GATA3)p

Part III: Design of G8p

Plasmid: pGL4.22-G8p

Fig5.3.1 the structure of G8p

Part IV: Primer design

Tab.5.4.1 The list of primer of promoter for PCR

Part V: construction of synthetic promoter

We use the JASPER to get the TF binding sites (TF-BSs), and add different spacers between the tandem repeats of TF-BSs to avoid creating new binding sites in order to ensure the specificity.

Part VI: Test of promoter

1.Protomer selection

2.efficiency test

Task Six: Golden gate

August 6-20

Aiming at connecting Module1 with Module2, we utilize Golden gate method.

Part I: Basic Plasmid

Plasmid: pEGFP-N1-lacZ

Fig.6.1.1 the sequence of BsmBI-lacZp+lacZ-BsmBI

Part II: Modified design of Module1

The recognition site and cutting site of BsmBI in Module1

Part III: Modified design of Module2

1.Basic Vector: pEGFP-N1-lacZ

2.Promoter region: BsmBI RS-s(ESR1)p-BsmBI RS

3.screening and identification region: BsmBI RS-lacZp-lacZ-BsmBI RS

4.Final construction

The recognition site and cutting site of BsmBI in Module2

4.1 pEGFP-N1-Module2(148b): pEGFP-N1-s(ESR1)p-(Sponge-148b)-（miR-148b-BS）

4.2 pEGFP-N1-Module2(141): pEGFP-N1-s(ESR1)p-(Sponge-141)-（miR-141-BS）

Fig.6.3 the structure of Sponge-miR141 with BsmBI Recognition Site

Part IV: Result of construction of plasmid and important elements

Task Seven: Construction of Module1

August 24-30

Part I: construction of pLN431-s(GATA3)p-GAD-miR101-BS

1. the basic plasmid:pLN431
2. the promoter s(GATA3)p
3. the synthetic TF: GAD——GALBD+ VP16 AD
4. the binding site of miRNA: miR-101-BS
5. the Golden gate connection

Fig.7.1 the process of golden gate connection for the whole Module1

Fig7.2 the whole structure of Module1 after connecting

Fig 7.3 the structure of GAD

Part II

Amplify the plasmid connected and send to sequence.

Task Eight: Design of Module2

September 13-20

Part I: Primers with enzyme recognition site

Tab.1 sequence of primers

Part II: Construction of pEGFP-N1-s(ESR1)p-Sponge

1. Elements and connection

1.1 Sponge of miR-141 and miR-148b

Tab.8.2 Sequence of miR-sponge with BsmBI recognition site

Items	Sequence ( 5’→3’）	Length
Sponge-141-BsmBI	CGTCTCCAGCCGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGGATAGGTAGAAGGAATGTCACAACCAGATAGACCAACACTGTAAGGAAGATGCTCGGGAGACG	225
Sponge-148b-BsmBI	CGTCTCCAGCCACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTAGACAAAGTTGTGAAATGCACTGACTCGGGAGACG	226

1.2 basic vector: pEGFP-N1

Fig.8.2.1 the structure of vector

1.3 Promoter: s(ESR1)p

1.4 Connection: Golden gate method

Part III: the structure of Module2 after Golden gate connecting

Part IV

Amplify the plasmid connected and send to sequence.

Task Nine: Design of Module3

September 2-11

Part I: sequence of primers

Part II: G8p Plasmid construction

Structure: pLN431-G8p-yCD-(miR-BS)

Fig,9.2.1 the structure of pLN431

Fig.9.2.2 the structure of G8p

Fig.9.2.3 the structure of yCD

Part III：Test when Module1+Module3 to examine whether G8p can express

Task Ten: DAPI Staining for final test whether the whole system can work

October 8-11

Comparing Day2 and Day3, we notice that the whole system transfected into MDA-MB-231 cells work successfully and kill TNBC cells efficiently and specifically.

Task Eleven: Transferrin

September 21-29

Part I Transferrin-TFR binding motif

Part II microscope observation