Team:SYSU-CHINA/Notebook
Molecular Experiment Record
2019.5.18
Streak E.coli containing pL7Ae and pL7AeMUT onto the LB plate. After 14 hours, pick a single colony and patch it to a new plate.
2019.5.19
1. Colony PCR
Primers: L7Ae-F-KpnI and L7Ae-R-BamHI primers
Enzyme: Taq
2. Detection by agarose gel electrophoresis: negative.
Analysis: Primer design error, the restriction enzyme cutting site is in the 3' end of the primer
2019.5.26
1. Cultivate the bacteria to be ready for extracting pL7Ae and pL7AeMUT:
Escherichia coli containing pL7Ae and pL7AeMUT was inoculated in 3L Amp+ LB medium at 37 °C overnight.
2. Screen positive bacteria:
Streak E.coli containing pL7Ae and pL7AeMUT on the LB plate. After 14 hours, pick a single colony and patch it to a new plate. After 12 hours of incubation, the patch plate was stored at 4 ° C for detection.
2019.5.27
1. Extraction of plasmid: Plasmid pL7Ae and pL7AeMUT were extracted using Omega E.Z.N.A Plasmid Mini Kit.
2. DNA concentration determination: L7Ae (69.1 ng / μL) ; L7AeMUT (54.3 ng / μL)
2019.5.31
1. PCR amplification:
L7Ae and L7AeMUT were amplified by PCR using Phata enzyme and BamHI/XhoI enzyme cutting site and Myc tag were introduced. The primers are as follows:
L7Ae-Fw-BamHI: 5'-AAGGATCCATCATATGCGGCCGCTTATGTACGTGAGATTTGAGG-3’
L7Ae-Re-Myc-XhoI:5'-CTCGAGTTAATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCGAAGGGCCCTCTAGACTCCTTCTGAAGGCCTTTAATCTT-3’
2. Identification by agarose gel electrophoresis: the amount of product should be 440 bp, but the band is too wide, so consider increasing the annealing temperature and re-PCR
2019.6.1
1. PCR amplification under improved conditions: Amplify L7Ae and L7AeMUT using the above primers, and increase the annealing temperature to 58 °C for higher amplification specificity.
2. Agarose gel electrophoresis: higher band specificity was shown.
3. Gel extraction: The target product was extracted with omega Gel Extraction Kit to obtain L7Ae-Myc and L7AeMUT-Myc DNA fragments. Store at 4 ° C.
2019.6.2
1.DNA concentration detection: UV spectrophotometer detects the concentration of extracted L7Ae-Myc and L7AeMUT-Myc fragments: L7Ae-Myc: 169 ng/μL; L7AeMUT-Myc: 116 ng/μL
2. Digestion: double enzyme digestion of pcDNA3.1, L7Ae-Myc, L7AeMUT-Myc. The systems are as follows (unit μL):
React for two hours at room temperature. Heat in a 70 °C water bath for 10 min to inactivate enzyme.
2. Separation of the digested product by agarose gel electrophoresis:
Only the pcDNA3.1 product was seen, and no L7Ae-Myc and L7AeMUT-Myc fragments were found, which were suspected to be lost during the gel recovery process.
3. Re-PCR amplification
The L7Ae and L7AeMUT were re-amplified using primers L7Ae-Fw-BamHI and L7Ae-Re-Myc-XhoI, and the annealing temperature was set to 57 ° C to increase the amplification specificity. The system is as follows (unit μL):
4. Detection of recovered product by agarose gel electrophoresis
Products: L7Ae-Myc and L7AeMUT-Myc both showed the target band
5. Gel extraction:
The target product was extracted with omega Gel Extraction Kit to obtain L7Ae-Myc (GSF) and L7AeMUT-Myc (GSF) DNA fragments, which were stored at 4 ° C.
6. DNA concentration detection: UV spectrophotometer detects the extracted L7Ae-Myc (GSF) and L7AeMUT-Myc (GSF) fragments:
L7Ae-Myc (GSF): 160 ng/μL; L7AeMUT-Myc (GSF): 110 ng/μL
7. Colony PCR
Use the 5.26 preserved patch plate, pick L7Ae and L7AeMUT positive for colony PCR amplification, using primers:
L7Ae-Text-Fw: ATGTACGTGAGATTTGAGGTTC
L7Ae-Text-Re: TTACTTCTGAAGGCCTTTAATCTT
8. Agarose gel electrophoresis test:
All positive
9. Amplify positive clones to be ready for preservation
L7Ae and L7AeMUT positive clones were inoculated to 5 mL of Amp+ (1000x) LB liquid medium, and shaken at 37 ° C overnight.
2019.6.3
1. Conservation of DH5α-L7Ae and DH5α-L7AeMUT
2 tubes of DH5α-L7Ae and DH5α-L7AeMUT were stored in 15% glycerol and placed at -80 °C
2. The overnight digestion product was collected and inactivated in a water bath at 70 ° C for 10 min. Only the pcDNA3.0 band could be seen. No gene fragment band.
3. Improve digestion condition
According to NEB protocol, the enzyme should be digested for 5-15 minutes. Considering the lower enzyme digestion efficiency of XhoI, the enzyme digestion was carried out in the same system for 25 minutes at room temperature and 5 minutes at 65 °C.
4. Column extract product
Directly extract the digested products L7Ae-Myc-BamHI-XhoI and L7AeMUT-Myc-BamHI-XhoI (undetermined concentration) using Omega Gel Extraction Kit
5. T4 ligase connection
The T4 ligase was used to link the gene to the vector. Since the concentration was not determined, the following system did not conform to the gene: vector >3:1 recommendation.
The system is as follows (unit μL):
After 1 h incubation at room temperature, the reaction was terminated by inactivation at 65 ° C for 5 min. Product stored at 4 ° C
2019.6.4
1. Column extract product
Extract the enzymatically linked products pcDNA3.1-L7Ae-Myc-BamHI-XhoI and pcDNA3.1-L7AeMUT-Myc using Omega Gel Extraction Kit
2. Escherichia coli DH5α plasmid transformation
Two tubes of DH5α competent were taken and the ligated plasmids pcDNA3.1-L7Ae-Myc-BamHI-XhoI and pcDNA3.1-L7AeMUT-Myc were transformed, respectively. The system is as follows:
Mix and incubate for 30 min on ice. Heat shock at 42 °C for 70 s.
After adding 1L LB medium, resuscitate at 37 ° C for 1 h
Centrifuge at 10000xg for 2min, discard the supernatant, add 200ml and resuspend The suspension was coated with Amp+ resistant LB plate and cultured at 37 °C.
2019.6.5
No positive colonies after E. coli transformation
2019.6.8
1. Improved enzyme digestion conditions
Re-cut and adjust the digestion time to 15 min. Reset the enzyme system and increase the amount of carrier added to 5μl. 37 ° C enzyme ligation for 1 h.
2. Improved transformation conditions
The enzyme-linked product was directly added to the DH5α competent state without column purification, and the enzyme-linked product was added to 10 μl. Ice incubation time extended to 1h. Add ampicillin to LB liquid medium during resuscitation.
2019.6.9
1. 4 plates produce positive
Analysis: It can be seen that the previous unsuccessful conversion problem is not in the plasmid, but in the conversion process and conditional issues.
Patch positives expanded for 5h.
2. Identification of positives by primer L7Ae-Text-Fw and L7Ae-Text-Re colony PCR
The test was fully positive and the plasmid was successfully constructed.
Inoculate and overnight shaking.
2019.6.10
1. Endotoxin-free extract plasmid endo-pcDNA3.1-L7AeMUT and endo-pcDNA3.1-L7Ae
2. Mr. He Lei provided E.coli containing the pcDNA-EGFP plasmid. Inoculate it in LB to prepare for extracting plasmids.
2019.6.14
1. DNA concentration detection
UV spectrophotometer was used to detect endo-pcDNA3.1-L7AeMUT and endo-pcDNA3.1-L7Ae concentrations:
endo-pcDNA3.1-L7AeMUT: 264.35 ng/μL; endo-pcDNA3.1-L7Ae: 209.35 ng/μL
2019.6.24
1. Plasmid extraction
pTK295, pEF1α_reTA3, pTRE_EGFP2, pAdeasy: extract plasmid (endotoxin-free)
pShuttle, pAdTrack, pAVV-Ubc, LSBr5and3: extract plasmid (not endotoxin-free)
2019.6.29
1. Gel extraction of 1xKt-EGFP and 2xKt-EGFP
2. UV spectrophotometer to measure concentration
1xKt-EGFP: 43.6 ng/uL ; 2xKt-EGFP: 64.3ng/uL
3. Inoculate DH5α-pcDNA3.1 in LB medium. Shake overnight.
To be continued……
To know more about our experiment arrangement and work flow, please refer to these intact experiment records below.