Parts
Parts Overview
<groupparts>iGEM19 MichiganState</groupparts>
Basic Part
ghoT Toxin BBa_K2919000
The ghoT gene is the toxic part of the ghoST toxin-antitoxin system. This is a Type V toxin-antitoxin system where the antitoxin forms a protein that cleaves the mRNA of the toxin. When expressed the ghoT toxin forms a short helical transmembrane protein that creates pores in lipid bilayers. The pores in the membranes prevent a proton gradient from being built up and therefore prevent energy production in the cell causing slow growth or even cell death.
Sequence
atggccttgttcagcaaaatcttgatcttctatgtcatcggcgtcaacatcagcttcgtcatcatctggttcatcagccatgaaaaa acccatatccgcttgttgtcggccttcttggtcggcatcacctggccgatgagcttgccggtcgccttgttgttcagcttgttctga