Team:MichiganState/Parts

Parts

Parts Overview

<groupparts>iGEM19 MichiganState</groupparts>

Basic Part

ghoT Toxin BBa_K2919000

The ghoT gene is the toxic part of the ghoST toxin-antitoxin system. This is a Type V toxin-antitoxin system where the antitoxin forms a protein that cleaves the mRNA of the toxin. When expressed the ghoT toxin forms a short helical transmembrane protein that creates pores in lipid bilayers. The pores in the membranes prevent a proton gradient from being built up and therefore prevent energy production in the cell causing slow growth or even cell death.

Figure 1 (top) This figure shows the OD vs time of E. cloni 10G strains that are transformed with pCM80 (dotted lines) and pCM80 + ghoT toxin (solid lines). This graph was generated by growing E. coli with the pCM80 plasmid and the E. coli with pCM80 + ghoT with varying amounts of cumate. The different concentrations of cumate activate the toxin promoter and with more cumate the less growth there is as a result of the ghoT toxin. The different concentrations of cumate were also used with transformants that had the pCM80 no insert plasmid to show that the cumate was not toxic.

Sequence

atggccttgttcagcaaaatcttgatcttctatgtcatcggcgtcaacatcagcttcgtcatcatctggttcatcagccatgaaaaa acccatatccgcttgttgtcggccttcttggtcggcatcacctggccgatgagcttgccggtcgccttgttgttcagcttgttctga