Difference between revisions of "Team:TU Dresden/Notebook"

Figure 2 – SDS-PAGE of the purification process of the dCas9-eGFP fusion protein. During the purification process we took several samples, which were loaded in the end on an SDS-page to monitor the purification process. The fusion protein is very big. dCas9 alone is 160 kDa [1] and eGFP as well as MBP add another 30-40 kDa each [2]

Aliona Bodganova, working at the MPI protein facility kindly agreed to support our project by teaching us how to express, purify and enrich a dCas9-eGFP fusion protein. Furthermore we could keep the purified protein, which was very helpful to do first experiments with the interaction with cellulose and binding to the target DNA, before our own construct was ready. The SDS-PAGE of the protein purification is shown in Figure 2.

The size of the complete product lies therefore around 230 kDa and it can be seen in already in the raw cell lysate as a band above the last band of the protein marker. The protein was once purified via amylose resin column with the a N-terminal-MBP-tag. The MBP-elution shows why this is necessary. The very big fusion protein is often truncated by the bacteria, and purification via only MBP shows that many truncated versions are present. Only after additional purification on the SP column is the only visible band that of the full transcript.

The complete protocol on how to purify a dCas9-fusion protein, which we wrote after the Days with Aliona can be found here

Figure 3 – Planning of site-directed mutagenesis PCR

Four different new BioBricks were needed to get our planned construct ready: dCas9*, MBP, HRP and the linker (Figure 3). The Strep-tag that we used was an old BioBrick.
 

Because of a forbidden restriction enzyme site (EcorRI) in the middle of the dCas9 sequence, it was necessary to do a site-directed mutagenesis. Therefore, we designed four primers, two of which overlap with 20 basepairs around the EcoRI-site and carry the mutated base A->T. The part upstream and downstream of the mutation will be amplified in two separate PCRs (PCR 1 to 2 and 3 to 4). The product of this PCRs will be the substrate for the last PCR (1 to 4), in which the whole sequence is finally amplified.

30th July – Paula and Mara

The first two PCRs had the difficulty that the additional base pairs added by the prefix and suffix required a change in annealing temperature after the first few cycles. We solved this by designing the PCR in a way, that the first cycles were a three-step and the last cycles a two-step PCR. The number of cycles was generally kept low to minimize the probability of accumulating mutations in the coding sequence.

The PCR was performed in the following way:

   10 µL NEB MasterMix Q5
   7 µl H2O
   1 µL sample
   1 µl each primer
   [20 µl total reaction volume]

*All later mentioned PCRs were done with this protocol The PCR was done with the following protocol:

In an additional PCR we tried the amplify the linker-sequence, from a plasmid provided by Aliona Bodganova from the MPI protein facility. The plasmid carries a dCas9-GFP fusion protein with a linker sequence in between. Since this product has proven to work, we decided to use the same linker fragment, getting it out of the plasmid by PCR and adding the prefix and suffix via primer overhangs. The linker is very short and with the prefix and suffix would be around 100 bp of length. As can be seen in the gel this very short amplicon is not visible (Figure 5).

Since also the bands of the ladder of smaller size are not visible we decided to repeat the PCR and run on a higher percentage agarose gel.

31st July – Paula and Mara

To get the final PCR with primers 1 and 4 to work, we changed the annealing temperature to 55 °C and increased the extension time to 2 minutes.

The first two PCRs were repeated to have more material to work with while establishing the final PCR. With the adjusted parameters PCR 1 to 4 showed three different amplicons. The amplicon of interest at 4.2 kb, but also the shorter amplicons of the first two PCRs. Eventhough, only 1 µL of PCR 1 to 2 and of PCR 3 to 4 were taken as sample for the final PCR it might not have been enough of a dilution factor and the wrong amplicons are caused by leftover primers from the first PCRs. Therefore the PCR product was loaded on a TAE gel and the band at 4.2 kb (shown in Figure 6) was cut out from the gel and purified via gel purification Kit (Test-samples received from Jena Bioscience).

The PCR for amplifying the linker fragement was repeated with the same PCR program but then run on a 2% agarose gel and successfull amplification of the small fragment could be seen (Figure 7).

The product of the PCR was as well loaded on a TAE gel and purified with the same Kit.

Overnight cultures were set from pSB1C3 - [RFP] and pSB1C3 - [strep] plasmids. Both of which were kindly provided by an old iGEM member of TU Dresden, Philipp Popp.

1st July – Paula and Mara

The overnight cultures were minipreped and the pSB1C3 - [RFP] digested with EcoRI (E) and PstI (P). The PCR products for the linker and the complete dCas9 were as well digested with the same enzymes ligated and transformed as given in the NEB BioBrick instructions. The bands seen on the gel were thought to have a high enough concentration to make a transformation possible.

The pSB1C3 - [strep] was sent for sequencing with our generously sponsored Eurofins overnight sequencing barcodes (with primer TM2889). The sequence was successfully verified: Link to sequencing result. 100 µL of ligation were plated on chloramphenicol containing plates.

20th July – Sebastian and Nikitha

From the plates with the ligated linker and dCas9 fragments, clones were picked and grown over night at 37°C, 950 rpm in a thermoshaker.

21st July – Sebastian and Nikitha

MW: 1 kb DNA Ladder 1: pSB1C3-Linker
EcoRI + PstI
1. 2029 bp
2. 102 bp


2: pCas9-19_pOCC97-cas9-dead
EcoRI + PstI
1. 7828 bp
2. 2809 bp


3: pSB1C3-dCas9_RFC25
EcoRI + PstI
1. 4173 bp
2. 2029 bp


From the in silica gel created with SnapGene (Figure 8), it is obvious that none of the clones was positive (Figure 9).

30th July – Sebastian and Nikitha

The gBlocks ordered for the two BioBricks of MBP and HRP arrived from IDT, were resuspended in water and digested the following way:

HRP-isoform C and MBP:
gBlock 43 µL
10x 2.1 NEB Buffer 5 µL
EcoRI-HF 1 µL
PstI 1 µL


500 ng of pSB1C3 were digested as given by NEB, the linearizd plasmid was run on an agarose TAE gel, the lane of interest was cut from the gel and purified. The yield of purified linearized plasmid was at 15 ng/µl.

The digested gBlocks were ligated into the linearized plasmid following the NEB protocol and electroporated at 1350 V into electrocompetent prepared with the following protocol: Link to protocol. After electroporation the bacteria were given time to recover in media without LB for one hour in a thermoshaker at 37 °C, 950rpm.

Afterwards a 1:100 dilution was prepared and 100 µL of the dilution plated on Chloramphenicol containing plates.

3rd August – Paula and Mara

To verify the successful insertion of the gBlocks in the plasmid, 1.5 mL liquid cultures containing 30 ng/µl chloramphenicol were set up with colonies picked from the plates plated on the 30th July. Ten colonies were picked for each BioBrick.

4th August – Paula and Mara

The colonies from the day before were grown overnight and minipreped the next morning with a kit provided by our sponsor (Zymo Research). The obtained plasmids were digested with E and P and loaded on an agarose gel as follows.

Comparing with the in silica gel made with SnapGene it is obvious that the colony number 8 (marked with an asterix) was positive (Figure 10). The bands match the expected sizes (given to the right) very well, eventhough the third band of the complete plasmid is also visible, which shows that the digest was not complete.

Comparing to the in silica gel and the expected sizes calculated in SnapGene it can be seen that three colonies carry the insertion (clones 3, 7 and 8) (Figure 11). The clones of interest were again grown overnight in a liquid culture, because it was not enough plasmid DNA left to send for sequencing.

5th August – Paula and Mara

The cultures from the positive clones identified the day before were minipreped with the Zymo-Kit. The protocol was changed by omitting the binding column and precipitating the DNA with isopropanol instead, which increased the yield. The plasmid DNA was sent for sequencing and the sequences were successfully verified: Link to sequencing result.

To elucidate the problem of why the PCR for mutating the dCas9 sequence did not work, three PCRs were performed. We wrote the following program presented in Table 4.

Three PCRs were performed:
A - Y = 6; X = 11
B - Y = 12, X = 22
C - the program was split into two PCRs in which the 3-step part had no additional primers added
(only the overhangs from primers 2 and 3) and before starting the 2-step part primers 1 and 4 were added.

The amplicon of interest was only amplified in PCR B. It might be that because of the increased cycle number the lane is visible in B but not in A and amplification was also successful in A. In PCR C only the two smaller fragments were amplified but not the big one (Figure 12).

7th August – Paula and Mara

The BioBricks that were successfully verified by sequencing, MBP, HRP and strep were midipreped to have a large amount for later exeriments. At the same time the pSB1C3-[RFP] and the pSB1A3-[RFP] plasmids were midipreped as well. All midipreps were done with a Zymo-Kit with 50 mL cultures.

From each midiprep 200 ng were digested with E+P and separated on an agarose gel (Figure 13).

The plasmids with RFP insert and the BioBricks were successfully verified. PCR 1 to 2 was redone successfully, as well as PCR 3-4 (gel not shown) to have a sufficient amount of DNA for the purification (with a PCR purification Kit from Jena Bioscience) and subsequent repeat of the proven to work PCR B as done on the 5th August. The unspecific amplicons of the smaller fragments seen on that day, were probably taking activity and ressources from the polymerase, so the amount of DNA we got was too small for the transformation we tried. For this reason purifying the new PCR 1 to 2 and 3 to 4, removing all the old primers, would hopefully lead to a single amplicon of sufficient concentration.

9th August – Paula and Mara

The PCR 1 to 4 was repeated with the purified samples from the 7th of August with the PCR protocol as given on the 30th July.

As can be seen from the gel, the PCR was finally successful, with a strong amplification of the amplicon of interest and no unspecific amplification (Figure 14). To test if the EcoRI site was successfully mutated and not recognized by the restriction enzyme anymore, 200 ng of DNA were digested with EcoRI and run on a gel. As can be seen on the right the fragment is not digested. The former forbidden restriction enzyme site is therefore proven to be removed.

10th August – Paula and Mara

The PCR amplified dCas9* sequence was digested with E and P, ligated into pSB1C3, electroporated into GB05 and plated as described earlier.

11th August – Paula and Mara

From the plates 10 clones were picked and set up to grow in 2 mL liquid media with Cm overnight.

12th August – Paula and Mara

The overnight cultures were minipreped, digested with E and P and separated on an agarose gel. Five clones were positive and two of then were sent for sequencing, to check for the accumulated mutations during the PCR cycles.

Figure 16 – The scheme shows systematically how we were adding our different BioBricks together to the final construct, All basic BioBricks were cloned in pSB1C3, for the first fusions transferred to pSB1A3 and for the final construct cloned in pOCC97 (Kn resistance), bold and darker shaded BioBricks are newly designed by our team and lighter are BioBricks used from old teams. On each arrow the enzymes for this specific digest are indicated with their first letter.

12th August – Paula and Mara

As first two BioBricks the HRP and the Strep-tag were added together with the RCF25 enzymes. Therefore the following digest was set up:

pSB1C3 - [HRP] with E and AgeI (A) in CutSmart
pSB1C3 - [Strep] with P and NgoMIV (N) in NEB buffer 1.1
pSB1A3 - [RFP] with E and P in NEB buffer 2.1


Ligation, transformation and plating was performed as described before.

13th August – Paula and Mara

Seven clones were picked from the plates plated the day before and grown for 5 hours in liquid media. The cultures were then minipreped with the Zymo-Kit and isopropanol precipitation.

15th August – Paula and Mara

To be able to submit the pOCC97 expression plasmid, in which we will clone our final construct, we designed primers flanking both sides of the plasmid around the insertion site and amplified the backbone in a PCR with the following program shown in Table 5.

Table 5– PCR pOCC97 backbone program

pOCC97_fw: tactagtagcggccgctgcagCCGTTATAGAAGCTTGAGTATT
pOCC97_rev: gaattcgcggccgcttctagagGCCCATGGATATATCTCCTTCT

17th August – Paula and Mara

The linker BioBrick which could not be amplified by PCR was ordered from IDT in RCF25 standard as a gBlock. The dried gBlock was resuspended, digested with E and P and ligated into pSB1C3-[RFP].

20th August – Paula and Mara

The cultures from the day before were and minipreped and restriction digested with EcoRV, PstI the different enzyme was chosen to make it possible to see the very tiny fragment (100 bp) of the linker in comparison to the pSB1C3[RFP], which was digested with EcoRI, EcoRV, PstI.

The expected bands for the linker are at 1133 bp and 998 bp (Figure 17). For the pSB1C3[RFP] they are at 1133 bp, 1110 bp, 896 bp. The difference of the band at 896 bp and of 998 bp can clearly be seen. All clones successfully took up the linker fragment.

23rd Septermber – Paula and Sebastian

The dCas9 sequences were sequenced of several positive clones from the PCR of the 12th of August. The following cloning was done. MBP digested with E and N, Cas9 with A and P, HRP-strep with A and P, pSB1A3 with E and P, Linker with E and N. They were ligated in the following way:

MBP with dCas9 in pSB1A3
Linker with HRP-strep in pSB1A3

As described before the samples were transformed, plated, grown, picked, minipreped, E and P digested and analyzed on an agarose gel.

As can be seen on the gel, only the plasmid backbone is visible in all samples and not the fragment of interest (Figure 18). Therefore, the cloning was not successfull.

28th August – Sebastian and Paula

Restriction digestion was performed again to check if one of these clones have the construct with them. Restriction digestion was done with following enzymes: pSB1A3A with E and P, MBP with E + A, dCas9 with N + P HRP-strep with N +P. Appropriate fragments digested was cut out the gel and gel clean was performed (Figure 19). Two ligation was performed first, between MBP, dCas9 and pSB1A3 and second- pSB1A3, linker and HRP-strep. Ligated products were transformed and plated.

29th August – Sebastian and Paula

Transformed colonies were grown and miniprepped and loaded onto 0.8 % agarose gel to check if the ligation reaction worked (Figure 20). For MBP and dCas9 ligation, clone 2 worked with ligated product seen at 500 bp. In the second ligation reaction between Linker, HRP and Strep, all the clones had ligated product at 1000 bp and ligation was successful.

1st September – Sebastian and Paula

Ligation reaction between MBP-dCas9 (clone 3) and Linker-HRP-strep (clone 5) from 29.09.19. MBP-dCas9 was digested with E+A, linker-HRP-Strep with N + P and pSB1C3 with E +P. Triplicates of mini prepped clone 3 was digested and mini prep of 5 clones was performed and after restriction digest respective fragments (marked in red) was cut out and gel purification was carried out for final ligation (Figure 21).

7th September – Mara and Paula

Ligation reaction between MBP-dCas9 (clone 3) and Linker-HRP-strep (clone 5) from 29.09.19. MBP-dCas9 was digested with E+A, linker-HRP-Strep with N + P and pSB1C3 with E +P. Triplicates of mini prepped clone 3 was digested and mini prep of 5 clones was performed and after restriction digest respective fragments (marked in red) was cut out and gel purification was carried out for final ligation (Figure 21).

8th September – Mara and Paula

1. Ligating HRP-Strep in pOCC97 (expression vector) using E+P and optimizing CutSmart buffer for improved digestion by enzymes.
2. Cloning of Full construct in pOCC97 expression vector.

Expected fragment size of HRP-Strep (insert) 1 kb and the pOCC97 backbone is 5 kb. We do not see band of HRP-strep at 1 kb, most likely that this fragment ran out of gel and we only see the pOCC97 backbone (Figure 23).

Full construct was cloned into pOCC97 and digested with X +P to get two fragments at 5kb and 6 kb (Figure 24). However, these fragments were too close and could be resolved and visualized as individual bands.

In Figure 25 the agarose gel image stimulation of X +P digestion and resolution of the two fragments are presented.

It can be seen in the first lane (digested with X and P), that the difference in size between the backbone (5 kb) and the full construct (6 kb) is not sufficient to be properly separated on an agarose gel. Therefore a new restriction digest had to be prepared in which a triple digest with X, P and PmlI additionally was set up. The fragments of different size makes it easy to distinguish a successful insertion of the final construct in the expression plasmid.

9th September – Mara and Paula

1.Triple digestion of ligated full construct into pOCC97
2.Cloning of K1800002 into pOCC97 and digestion
3.Cloning of HRP-strep into pOCC97 and digestion

From the ligation replicate 1 and 2 we see three fragments in the 3rd lane and 8th lane, respectively (suggesting successful ligation into the pOCC97). However, HRP-Strep cloning into pOCC97 was not successful, since we could not see the third fragment.

10th September – Mara and Sebastian

We amplified sry gene (template buccal swab from Sebastian) using the following forward and reverse primers:


Forward - AGTAAAATAAGTTTCGAACTCTGG
Reverse - AGGCCTTTATTAGCCAGAGAAAA, annealing temperature 55 ℃ (Figure 27).

11th September – Mara and Sebastian

All the ligated clones were mini prepped and digested with PmlI, EcoRI and Pst1. Positive clones (marked in red) had 1 kb fragment of HRP and they were selected for expression of HRP and HRP- Strep respectively (Figure 28).

12th September – Mara and Sophie

Final clone check of pOCC97 expressing dCas9-HRP construct using triple restriction digestion PmlI, X and P.

Final clone check of pOCC97 expressing K1800002 construct using triple restriction digestion PmlI, EcoRI and Pst1.

Final clone check of pOCC97 expressing HRP-strep construct using triple restriction digestion PmlI, EcoRI and Pst1.

Selected clones were used for respective protein expression.

The full construct, which is uploaded in a BioBrick as K3037003 was cloned into our expression plasmid K3037000, and was expressed overnight. First expression was done at 37°C for seven hours, induced with 1mM IPTG.

Figure 32 - Expression of full construct in pOCC97 not optimized (BBa_K3037000)

The full construct is 230 kDa and can be seen at the expected size on the gel (Figure 32). On the time point before induction, the band of the protein of interest can not be seen. This shows that our induction is specific and the promoter is not leaking.

To identify the perfect conditions for expression of this novel protein, which did not exist before, we tested different IPTG concentrations and different temperatures (Figure 33). From the fusion protein that we used before (eGFP-dCas9) we knew that a protein of similar size was expressed in the same strain of E.coli pRARE T7 at 18°C, which improved proper folding. Therefore, we wanted to test this condition with our protein. As a comparison we used the natural growth conditions of E.coli, at 37°C, to compare if the amount of protein, we would obtain would reduce with the reduced temperature. At the same time we checked different insertions in the expression plasmid. Which are marked as optimized and not optimized pOCC97.IPTG concentrations were checked from 0.5, 1.0 to 1.5 mM.

Figure 33 - Different IPTG concentrations and temperature to test the expression of the novel protein

The SDS-PAGEs shown above were analyzed with Fiji (Figure 34). The intensity of each band was normalized against the background of its corresponding lane. Additionally, for the single data points the values were normalized from zero to one. Different temperatures:

Graph 1 - Analysis of novel protein expression performed in Fiji

It is important to note, that the fourth time point is after overnight expression (8 hours after time point 3, the other timepoints are 1 hour apart).

On each graph the Full construct 11 and Clone 7 are the same sequence of our fusion protein. The difference is the way how they are integrated in the expression plasmid. The clone number 11, is using the RBS of the Freiburg standart (Shine-Dalgarno-Sequence), while the clone 7 has additionally a longer space with the native RBS of the POCC97 between the Promoter and the shine-dalgarno sequence. It can not be inferred from the data what exactly is causing differences in expression, but differences can be observed. First of all the total amount of recombinant protein expressed does not differ between both expression constructs, as estimated from the image analysis of the SDS-pages, but the expression with clone 7 seems more robust. Comparing the expression at different temperatures and different IPTG concentrations does not lead to strong differences in the final amount for clone 7, but does show strong differences for clone 11. For clone eleven a strong dependence on the IPTG concentration, which differently influences expression over time, can be seen in Figure 33 and Graph 1.

While the higher amount of IPTG impaired expression at 37°C it improved expression at 18°C. For both constructs the ideal concentration of IPTG is 0.5 mM. The higher amount of inducer does not lead to a higher expression of the protein of interest.

Since the expression is far more robust in the optimized plasmid backbone, we decided to perform future expressions in this construct. For this the expression at 18°C led to a higher protein amount than t = 37°C and an induction with 0.5mM led to higher expression than 1 mM. 0.2 mM had not been tested in this construct, but since 0.5mM proved to be the ideal expression concentration for the other construct at 18°C, we chose this to be our working concentration.

So the ideal conditions were identified as: Overnight, 18°C, 0.5mM IPTG, pOCC97_optimized.

In silico analysis of our new fusion protein is presented below.

Theoretical analysis of the expected parameters of the new protein (determined with ExPASy ProtParam tool):

Extinction coefficient: 205750

Estimated half-life > 30 hours in mammalian cells, >20 hours in yeast, >10 hours in E.coli.

The same way that we had to identify the ideal expression conditions by trial and comparison, we also had to establish the purification protocol for this new protein. We did this first by purification on an amylose resin of two cultures with each 500 mL culture grown for 18 hours at 18°C with 0.5mM IPTG.

Buffer compositions were adapted from Alionas protocol for eGFP-dCas9 purification.

Two different methods of binding to the column were investigated:

Figure 34 - Purification of the full construct from pOCC97 optimized in Amylose Resin column

Second via batch binding (Figure 35). The resin was pipetted into a falcon and incubated with the cell lysate for 1.5 hours on a rotator at 4°C.

Figure 35 - Purification of the full construct from pOCC97 optimized via batch

It can be seen that the band of interest is not visible before but well visible after induction. Additionally on both SDS-PAGES it is obvious that our protein has a good solubility, since the band of stronger intensity is in the supernatant and not in the pellet. Unfortunately, in both SDS-PAGES a strong band can be seen in the flow through, this results from overloading of the column. Since the column volume was only 1mL, the column was saturated and a lot of protein got lost. But the elutions show that only our protein eluted specifically with a lot of truncated versions that typically appear for very large proteins in E.coli, which is interrupting translation or transcription.

For the rest of the lab work after October 6th DOWNLOAD THE PDF

10th September - Nikitha and Sebastian

Materials:

-100 ng of PCR amplified sry gene
-200 ng of dCas9-GFP
-200 ng of guide RNA specifically targeting the amplified sry gene
-The 6 unique guide RNAs all targeting different regions of sry gene were designed. Using the online tool benchling and fasta sequence of sry gene, following guide RNAs were designed

Methods:

We wanted to check if the overall efficiency of mobility shift increases when combinations of guide RNAs are used, so individual reactions with combinations of guide RNA were used.

Guide RNA, dCas9-GFP and sry gene was incubated in reaction buffer (respective amounts mentioned in the materials section) for 37 °C for 1 hour.

Post incubation, they were mixed with loading dye without SDS, 20 % glycerol in Orange G dye and loaded onto 4-20 % gradient acrylamide- TBE precast gel. Gel was run for 3 hours at 75V in 1 x TBE buffer.

Gel was then stained using ETBR with 1 : 20000 dilution in 1x TBE for 10 minutes. The loading order is presented below (Figure 19):

Lane 1: 1 kb DNA ladder
Lane 2: sry gene
Lane 3: sry gene + dCas9
Lane 4: sry gene + dCas9 + guide RNA 1
Lane 5: sry gene + dCas9 + guide RNA 4, 2 and 6
Lane 6: sry gene + dCas9 + guide RNA 1, 5 and 6
Lane 7: sry gene + dCas9 + guide RNA 1, 4, 3 and 6
Lane 8: sry gene + dCas9 + guide RNA 4, 3 and 7
Lane 9: sry gene + dCas9 + guide RNA 1, 4 and 2

Lane 1 - There is a clear sry gene at 800 base pairs and when sry gene is incubated with only dCas9 (lane 2) there is no shift seen in the position of the gene. In lane 3, when guide RNA 1 was incubated with the dCas9 DNA reaction mix, we see a shift in the mobility, this is because of the protein DNA interaction and this binding is hindering the gene mobility. In lanes 5,6,7,8 and 9 combinations of guide RNAs were used. From lane 7 and 8 we see the highest mobility shift. From the electromobility shift assay performed above, we conclude that our expressed dCas9-GFP protein is functional and is able to successfully bind to gene with the help of appropriate guide RNAs.

11th September - Nikitha and Sebastian

We wanted to check if guide RNA alone is able to cause change in the mobility of sry gene Methods 1 to 4 was repeated and this gel ran for 3 hours in order to get rid of all the secondary structures of the RNA formed (seen at the bottom of the gels, where guide RNA was loaded) and following was the loading order (Figure 20):

Lane 1: Marker
Lane 2: sry gene
Lane 3: sry gene + guide RNA 1
Lane 4: sry gene + guide RNA 2
Lane 5: sry gene + guide RNA 4
Lane 6: sry gene + guide RNA 7
Lane 7: sry gene + dCas9
Lane 8: sry gene + dCas9 + guide RNA 1, 4 and 2
Lane 9: sry gene +dCas9 + guide RNA 3, 4 and 7
Lane 10: sry gene + dCas9 + guide RNA 1
Lane 11: guide RNA 1
Lane 12: dCas9-eGFP

From lane 3 till 7 , we do not see any difference in the mobility of sry gene when only guide RNA is added to the reaction mix. In Lane 8, 9 and 10 we see mobility shift of the gene and in lane 11, when only guide RNA was loaded , we see no bands and in lane 12, we see dCas9 in stacking part of gel, owing to higher molecular weight.

1. In order to characterize the functionality of our expressed full construct (dCas9-HRP), we performed gel shift assay using our expressed protein and specific guide RNAs targetingsry gene. Control for this experiment is dCas9-GFP (which was successful in binding and hindering the mobility of DNA).

2. Checking the binding efficiency of dCas9 protein to GFP with the help of guide RNA specific to eGFP. Here, K3037005 in K3037000 was cleaved with BsaI and NotI to cut the eGFP fragment out.

3. Proof of concept to demonstrate that our dCas9 protein is successfully able to bind to DNA immobilized on cellulose strip. Further before loading on gel, strip was washed with wash buffer (W1) to remove unbound proteins (Figure 41).

Figure 41 - Proof of dCas9 and DNA bound to cellulose interaction (Lanes 10, 11 and 19)

Lane 1 - Marker
Lane 2- 100 ng ofsry gene
Lane 3- sry + dCas9-HRP
Lane 4 -sry + dCas9-HRP+Guide RNA 1 + Guide RNA 4 +Guide RNA 2
Lane 5 -sry + dCas9-HRP+Guide RNA 1
Lane 6 -sry + dCas9-GFP+Guide RNA 1 + Guide RNA 4 +Guide RNA 2
Lane 7 - eGFP+dCas9-HRP+Guide RNA 7
Lane 8 - eGFP+dCas9-HRP+Guide RNA 7
Lane 9 - eGFP
Lane 10 -sry + dCas9-HRP+Guide RNA 1 + Guide RNA 4 +Guide RNA 2
(Heresry gene was immobilized on cellulose strip and addition of dCas9 proteins and guide RNA was all done in cellulose strip).
Lane 11 -sry + dCas9-GFP+Guide RNA 1 + Guide RNA 4 +Guide RNA 2
Lane 12 -sry gene loaded on cellulose strip.

In lane 2 when PCR amplifiedsry gene was loaded, a faint band is seen at 3 Kb, most likely that this band is visible is because we did not perform PCR gel clean up. In lane 3 - without the presence of guide RNA, dCas9 -HRP is not able to bind tosry. In lane 4 and 5 with the presence of specific guide RNA, dcas9-HRP is not able to bind tosry gene, indicating that our expressed full construct of dCas9-HRP is unable to bind to the DNA and is not functional.

In lane 6 - we have our positive control, where dCas9-GFP is successfully able to bind and hinder the mobility ofsry gene.

In lane 7- eGFP was not pulled by dCas9-HRP, proving again the non-functionality of the expressed protein. In lane 8 - eGFP was successfully bound to dCas9-GFP and pulled up. In lane 8 we see the digested band of eGFP. In lane 11 - we again do not see the pull up ofsry gene loaded on the cellulose strip with dCas9-HRP but in lane 12- when dCas9-GFP was loaded, we see the gene pull up showing the functionality and proof of concept of dCas-GFP functioning on the cellulose disc and this is specific interaction since all the unbound proteins were washed and removed out. Lastly, lane 12 just hassry gene loaded on the strip

In this EMSA we invesigate for the first timne if our full construct has an able dCas9, wich means if it is able to bind to the sry gene and cause the shft in the EMSA assay. Furthermore we investigated the different incubation times that Cas9 needs with its guideRNAs and the target DNA. The original protocol from the MPI stated that 1 hour of incubation was necessary ut we wanted to cut down this time.

Figure 42 - Proof that the dCas9 of our full construt is active (lane 3) and investigation of different incubation times (lane 7-12)

In lane three where our purified full construct was loaded in very high concentration the sry gene cannot even be seen anymore at the same height as the pure sry without shift. This could be due to several reasons. One theory was that the concentration is so high and the pull so strong that no gene is visible anymore. Otherwise it could just have been a pipetting mistake. The incubation time analysis showed that the ideal incubation time for our protein is not necessarily one hour, lowertime-points, even five minutes, showed identical shift.

5th July – Nikitha and Sebastian

For extracting DNA from cells, we followed the DNA extraction protocol.

7th July – Nikitha and Sebastian

1. Optimizing the cell lysis time for higher elution of DNA from Whatman cellulose disc. We quantified the concentration of DNA that we eluted from the Whatman cellulose disc. We performed the reaction in duplicates and found out that 1 minute of cell lysis works the best with lower variations in the concentration of duplicates. Concentrations of DNA with 1 minute lysis time is 30 - 40 ng/uL – (Graph 1).

Graph 1 - Nanodrop quantification of DNA eluted with varying lysis time

2. Optimizing lysis time and checking the optimal elution temperature for bound DNA from cellulose disc

Graph 2 – Concentrations of DNA eluted with varying lysis time and elution done at room temperature and the second part of the graph (legend grey) with same lysis time with elution done at 55 °C

From graph 2, we conclude that elution at 55 °C yielded more DNA but however, with higher variations in the duplicates.

3. Measuring the purity of eluted DNA

Graph 3 - Absorbance ratio at 260/280 nm to measure protein contamination

From Graph 3, we conclude that when elution is done at RT the ratio of absorbance at 260/280 nm is above 1.8 indicating no protein contamination, and also that they do not interfere with the concentration of DNA quantified earlier (Graphs 1 and 2).

23rd August – Nikitha and Sebastian

Taken as a basis cellulose paper based DNA and RNA extraction method established by Y. Zou et al. was modified in our experiment. A genomic DNA was extracted from the overnight grown GB05 cultures with the following DNA extraction procedures [1], [2]. To determine the relation between salt concentration used and the yield of DNA after the extraction procedure, different solutions of NaCl (50 mM, 100 mM and 500 mM) were applied in DNA precipitation step (Figure 1). The most intensive band was observed in the samples extracted with the addition of 100 mM of NaCl.

Additionally, to compare the efficacy of DNA interaction with different types of paper, prior to the agarose gel electrophoresis, the extracted DNA was loaded on nitrocellulose and cellulose discs. It was shown that DNA have slightly stronger interaction with nitrocellulose paper rather than with cellulose which resulted in the bands of much lower intensity on the agarose gel (Figure 1A).

In the separate experiment an additional washing step was performed after the nitrocellulose – and cellulose - DNA binding step. The obtained results are depicted in the Figure 2.

In case of the DNA – nitrocellulose interaction, the faint bands are observed only in the lanes 3 and 4, where there was no salt treatment performed. Meanwhile, in the rest of the lanes, almost no bands could be noticed, which might be due to very strong binding between the DNA and the nitrocellulose disc.

In order to get rid of any residual salts present in the samples, an additional washing step was performed with the buffer containing 10 mM Tris-HCl and 80% ethanol. It was expected that ethanol would remove residual salts bound to the cellulose strip. However, in the following experiment all DNA was eluted, and almost no band was observed.