<!DOCTYPE html>
RNA cell
Project: RNA cell: back to the origins
Authors: iGEM_GO_Paris_saclay
Wednesday, 3/7/2019
AIM: As a first step in proving the RNA World concept, we wanted to create an “RNA cell”, in which replicating RNA, rather than DNA, would be the support of genetic information.
Principle: In order to carry out this substitution of DNA, we clone and expresse 3 nucleases: A1, gp3 and yqcg and see if they can efficiently degrade bacterial DNA. In addition to these nucleases, we integrate a plasmid containing The Rna dependent Rna polymerase 5a viral protein which amplifies RNA°. We are going to replicate an anti-sens-GFP-RNA to produce a sens GFP-RNA ,so that RNA can be translated.
●
Cloning Gblocks of T7, B. subtilis and RdRp into pBAD24-MoClo (empty)
The cloning needs a molar ratio insert 2:1 plasmid.
1µL plasmid (PBAD24GG)
+2µL mix (enzymes ligase/XbaI)
+1µL buffer Golden Gate
+ x µL plasmid (for molarity ratio 2:1 cf table1)
Up to 20µL with water
A A | B B | C C | D D | |
1 1 | Endonuclease T7 | Nuclease B. subtilis | RdRp | |
2 2 | Volume (µL ) for Golden Gate cloning | 2 | 7 | 7 |
Table1
Heat at 37°C for 15min.
●
Transform pBAD24-Moclo + insert into DH5alpha (see protocol "heat shock plasmid transformation")
2µL pBAD24-Moclo +insert + 50µL competent DH5alpha on ice for 30min
Heatshock at 42°C for 45 seconds
Cool down on ice for 5min then spread on LB+glucose (0.2%) +Amp (100µL/mL)
37°C over night
Thursday, 4/7/2019
●
Results of transformation from July the third [pBAD24-Moclo+insert (endonuclease T7 or nuclease B. subtilis or RdRp)] : Hugues-Natacha-Clara
There are colonies on each Petri dishes (for each cloning) but just a few for the nuclease of B. subtilis.
●
Colony PCR of transformed cells [pBAD24-Moclo+insert (endonuclease T7 or nuclease B. subtilis or RdRp)]:
dNTP diluted 1/2
Primers diluted 1/10 : oligo 5: 557µL
oligo 6: 617 µL
6 colonies for each condition + control: Ligation gblock (endonuclease T7 or nuclease B. subtilis or RdRp) and pBAD 24 GG
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-5-Seq-pBAD-F | 5'- TGGCTATGCCATAGCATTTTTATCC | 55,6 |
3 3 | 2019GO-6-Seq-pBAD-R | 5'- GGT CTG ATT TAA TCT GTA TCA GGC TG | 55,3 |
Primer sequences for checking insertion of the inserts
A A | B B | |
1 1 | Buffer | 57,5µL |
2 2 | dNTP | 23µL |
3 3 | Oligo5 | 23µL |
4 4 | Oligo6 | 23µL |
5 5 | H2O | 195,5µL |
6 6 | TAQ | 3,45µL |
PCR master mix
Each colonies was striped on LB + AMP (100µg/mL)+ Glucose 0,2% before using it for the colony PCR and after was sown into liquid culture of LB + AMP + glucose 0.2%
Friday, 5/7/2019
Clara Natacha and Hugues:
●
Stripes of 6 transformed cells with pBAD24-MOCLO, and liquid culture with LB and 100µg/mL of Amp and 0,2% glucose
●
Result of the colony PCR of transformed cells with pBAD MoClo Rdrp and T7
WhatsApp Image 2019-07-05 at 17.27.04.jpeg

All expected signlals have correct sizes even for the golden gate for B. subtilis, so last time we took too much genetic material during the colony PCR
Monday, 8/7/2019
●
gblock of Rdrp, T7 in plasmid pBAD24 MoClo (Clara)
Cultures of DH5alpha cells containing pBAD24 MOCLO clone 1 & 4 and pBAD MoClo Rdrp clone 2' & 5' and pBAD MoClo T7 clone 1' were cultures. Then plasmid DNA extraction was done using NucleoSpin® Plasmid / Plasmid (NoLid) kit. Culture of bacteria containing pBAD24 MOCLO clone 1' to make stock tomorrow are done. Have to do the same for the other transformed cells pBAD MoClo Rdrp clone 2' & 5' and pBAD MoClo T7 clone 1' tomorrow.
Plasmid DNA extraction of pBADMoClo Rdrp clone 1 & 4 and pBADMoClo T7 clone 2 & 1. All DNAs' concentrations were measured with nanodrop.
Sent to sequencing pBADMoClo Rdrp clone 1 & 4 and pBADMoClo T7 clone 2 & 1.
A A | B B | |
1 1 | plasmid DNA name | Concentration (µg/µL) |
2 2 | pBADMoClo T7 clone 2 | 116 |
3 3 | pBADMoClp T7 clone 1 | 66 |
4 4 | pBADMoClo Rdrp clone 1 | 89 |
5 5 | pBADMoClo Rdrp clone 4 | 56 |
6 6 | pBAD24 MOCLO clone 1 | 42 |
7 7 | pBADMoClo T7 clone 1' | 16 |
8 8 | pBADMoClo Rdrp clone 5' | 23 |
9 9 | pBADMoClo Rdrp clone 2' | 29 |
10 10 |
Table3
●
Transformed cells DH5alpha with new golden gate of pBADMoClo nuclease of B. subtilis and the first one. 50 µL of bacteria were used for 1 µL of plasmid. => Tomorrow: Colony PCR and second selection
Tuesday, 9/7/2019
Culture of transformed cells with pBADMoClo Rdrp clone 2' & 5' and pBADMoClo T7 clone 1' for glycerol stock tomorrow.
Thursday, 11/7/2019
gblock in plasmid pBAD24MoClo (Clara)
●
Sequencing result: pBADMoClo T7 clone 1' & RDRP clone 2' great :D
●
Heat shock transformation in Keïo with T7 clone 1' & RDRP clone 2' (see protocol "Heatshock plasmid transformation")
Friday, 12/7/2019
●
Characterization of T7 nuclease and Rdrp (Clara)
A A | B B | C C | D D | E E | |
1 1 | Time | OD T7 nuclease | OD Rdrp | ||
2 2 | Without ARA | With ARA | Without ARA | With ARA | |
3 3 | 0 min | 0.43 | 0.43 | 0.65 | 0.65 |
4 4 | 30 min | 0.72 | 0.21 | 1.01 | 1.01 |
5 5 | 1 hour | 0.98 | 0.64 | 1.25 | 1.31 |
6 6 | 2 hour | 1.25 | 0.85 | 1.68 | 1.65 |
Table4
Monday, 15/7/2019
●
Isolation of clones keio T7 and keio Rdrp : Arnaud
Stripes from colonies are done in 2 agar plates with LB + amp + glu
Tuesday, 16/7/2019
●
Bacterial cultures for CFU and OD : Arnaud
keioZ1F'A1
keioZ1F'T7
keioZ1F'Rdrp
keioZ1F'Moclo
in LB + Amp + glu 3 mL
Culture overnight at 37°C
●
Glucose 20% solution : Arnaud
A solution of 500 mL is made with 100 g of Glucose anhydre and is filtrated.
Small solution of 100 mL are made with the big one to reduce contamination
Wednesday, 17/7/2019
Culture of isolated clones (Results) : Abdel_Arnaud
●
60mL culture of A1, T7, Moclo and Rdrp in LB + Amp after a preculture overnight in LB + amp + glucose. Liquide culture are diluted in order to have an O.D = 0.1 when starting the experiment. Beginning of induction with Ara when O.D = 0.4. At this moment, each bacterial solution are split in 2 new samples of 25mL. One with arabinose, one whitout.
●
O.D and droplet of dilutions in plate are done at different time point compared to the moment arabinose is added (minutes) : -30 ; +30 ; +90 ; +150 ; Tomorow (+1110)
●
When arabinose is added, another experiment is done with the bacterial culture. bacterial solutions are used for a perpetual O.D measurement with clariostar.
Results :
A A | B B | C C | D D | E E | F F | G G | H H | I I | J J | K K | L L | |
1 1 | Time | -30min | +30min | +90min | +150min | +tomorrow | ||||||
2 2 | Glu | Glu+Amp | Glu | Glu+Amp | Glu | Glu+Amp | Glu | Glu+Amp | Glu | Glu+Amp | ||
3 3 | A1 | Ara | -3 | -1 | -3 | -1 | -4 | -1 | -6 | -2 | ||
4 4 | 1,10E+01 | 9,00E+00 | 2,90E+01 | 8,00E+00 | 1,00E+01 | 3,40E+01 | 1,40E+01 | 1,50E+01 | ||||
5 5 | 2,30E+01 | 1,90E+01 | 2,90E+01 | 1,10E+01 | 1,60E+01 | 2,50E+01 | 1,20E+01 | 2,00E+01 | ||||
6 6 | 1,50E+01 | 2,00E+01 | 3,00E+01 | 1,00E+01 | 8,00E+00 | 3,10E+01 | 1,30E+01 | 1,90E+01 | ||||
7 7 | No Ara | -5 | -5 | -6 | -5 | -6 | -6 | -6 | -6 | -6 | -6 | |
8 8 | 5,00E+00 | 6,00E+00 | 7,00E+00 | 3,00E+01 | 4,00E+00 | 4,00E+00 | 1,40E+01 | 1,50E+01 | 2,20E+01 | 1,80E+01 | ||
9 9 | 9,00E+00 | 7,00E+00 | 1,10E+01 | 2,50E+01 | 3,00E+00 | 1,00E+01 | 1,30E+01 | 1,00E+01 | 1,40E+01 | 1,80E+01 | ||
10 10 | 7,00E+00 | 5,00E+00 | 5,00E+00 | 2,80E+01 | 6,00E+00 | 8,00E+00 | 1,10E+01 | 1,20E+01 | 1,70E+01 | 1,70E+01 | ||
11 11 | T7 | Ara | -1 | -1 | -2 | -1 | -2 | -1 | -6 | -2 | ||
12 12 | 2,50E+01 | 5,00E+00 | 1,00E+01 | 1,30E+01 | 2,80E+01 | 1,50E+01 | 1,00E+01 | 7,00E+00 | ||||
13 13 | 2,60E+01 | 9,00E+00 | 1,90E+01 | 1,50E+01 | 1,70E+01 | 2,50E+01 | 1,70E+01 | 5,00E+00 | ||||
14 14 | 2,10E+01 | 1,40E+01 | 1,70E+01 | 7,00E+00 | 7,00E+00 | 1,70E+01 | 1,70E+01 | 2,00E+00 | ||||
15 15 | No Ara | -4 | -4 | -5 | -5 | -5 | -5 | -5 | -5 | -4 | ||
16 16 | 1,50E+01 | 2,00E+01 | 1,40E+01 | 1,20E+01 | 2,40E+01 | 1,90E+01 | 1,00E+01 | 1,30E+01 | 1,40E+01 | |||
17 17 | 1,60E+01 | 1,60E+01 | 1,70E+01 | 2,20E+01 | 2,10E+01 | 2,30E+01 | 1,10E+01 | 9,00E+00 | 1,90E+01 | |||
18 18 | 1,90E+01 | 1,70E+01 | 1,70E+01 | 2,20E+01 | 2,60E+01 | 2,30E+01 | 4,00E+00 | 1,10E+01 | 1,90E+01 | |||
19 19 | Moclo | Ara | -5 | -5 | -6 | -6 | -6 | |||||
20 20 | 2,70E+01 | 1,80E+01 | 9,00E+00 | 1,00E+01 | 2,30E+01 | |||||||
21 21 | 1,80E+01 | 2,80E+01 | 5,00E+00 | 1,70E+01 | 2,50E+01 | |||||||
22 22 | 1,90E+01 | 2,20E+01 | 1,10E+01 | 1,30E+01 | 3,00E+01 | |||||||
23 23 | No Ara | -5 | -5 | -5 | -5 | -6 | -6 | -6 | -6 | |||
24 24 | 9,00E+00 | 1,50E+01 | 2,80E+01 | 1,90E+01 | 8,00E+00 | 8,00E+00 | 1,50E+01 | 1,90E+01 | ||||
25 25 | 1,60E+01 | 1,10E+01 | 2,80E+01 | 2,10E+01 | 6,00E+00 | 9,00E+00 | 9,00E+00 | 1,80E+01 | ||||
26 26 | 1,10E+01 | 1,40E+01 | 2,20E+01 | 2,80E+01 | 5,00E+00 | 1,40E+01 | 1,70E+01 | 2,10E+01 | ||||
27 27 | Rdrp | Ara | -5 | -5 | -5 | -5 | -6 | -6 | -6 | -6 | ||
28 28 | 2,10E+01 | 2,40E+01 | 2,80E+01 | 1,40E+01 | 8,00E+00 | 9,00E+00 | 9,00E+00 | 5,00E+00 | ||||
29 29 | 2,70E+01 | 1,40E+01 | 2,60E+01 | 2,70E+01 | 1,30E+01 | 8,00E+00 | 7,00E+00 | 1,00E+01 | ||||
30 30 | 2,50E+01 | 2,10E+01 | 2,80E+01 | 2,40E+01 | 9,00E+00 | 6,00E+00 | 1,20E+01 | 1,00E+01 | ||||
31 31 | No Ara | -4 | -5 | -5 | -5 | -6 | -6 | -6 | -6 | -6 | -6 | |
32 32 | 1,70E+01 | 4,00E+00 | 3,10E+01 | 2,40E+01 | 9,00E+00 | 1,00E+01 | 1,30E+01 | 1,50E+01 | 2,10E+01 | 1,80E+01 | ||
33 33 | 1,90E+01 | 1,30E+01 | 2,80E+01 | 2,60E+01 | 8,00E+00 | 7,00E+00 | 1,50E+01 | 1,20E+01 | 1,70E+01 | 2,20E+01 | ||
34 34 | 2,40E+01 | 4,00E+00 | 2,50E+01 | 2,60E+01 | 8,00E+00 | 9,00E+00 | 1,60E+01 | 1,10E+01 | 1,90E+01 | 2,10E+01 |
Table5
A A | B B | C C | D D | E E | F F | G G | |
1 1 | O.D | TIME | |||||
2 2 | -30 | 30 | 90 | 150 | 1110 | ||
3 3 | A1 | Ara | 0,25 | 0,60 | 0,59 | 0,57 | 2,90 |
4 4 | No ara | 0,25 | 0,77 | 1,70 | 1,88 | 4,20 | |
5 5 | T7 | Ara | 0,18 | 0,42 | 0,37 | 0,38 | 2,80 |
6 6 | No ara | 0,18 | 0,62 | 1,09 | 1,62 | 1,00 | |
7 7 | Moclo | Ara | 0,16 | 0,70 | 1,15 | 1,54 | 3,90 |
8 8 | No ara | 0,16 | 0,77 | 1,38 | 1,85 | 3,90 | |
9 9 | Rdrp | Ara | 0,18 | 0,71 | 1,20 | 1,56 | 5,50 |
10 10 | No ara | 0,18 | 0,74 | 1,37 | 1,84 | 3,90 |
Table6
Thursday, 18/7/2019
Culture of isolated clones (Results) : Abdel_Arnaud
●
60mL culture of A1, T7, Moclo and Rdrp in LB + Amp after a preculture overnight in LB + amp + glucose. Liquide culture are diluted in order to have an O.D = 0.1 when starting the experiment. Beginning of induction with Ara when O.D = 0.4. At this moment, each bacterial solution are split in 2 new samples of 25mL. One with arabinose, one whitout.
●
O.D and droplet of dilutions in plate are done at different time point compared to the moment arabinose is added (minutes) : -30 ; +30 ; +90 ; +150 ; Tomorow (+1110)
●
When arabinose is added, another experiment is done with the bacterial culture. bacterial solutions are used for a perpetual O.D measurement with clariostar.
Results :
A A | B B | C C | D D | E E | F F | G G | H H | I I | J J | K K | L L | |
1 1 | Time | -30min | +30min | +90min | +150min | +tomorrow | ||||||
2 2 | Glu | Glu+Amp | Glu | Glu+Amp | Glu | Glu+Amp | Glu | Glu+Amp | Glu | Glu+Amp | ||
3 3 | A1 | Ara | -3 | -2 | -3 | -2 | -3 | |||||
4 4 | 20 | 9 | 44 | 3 | 32 | |||||||
5 5 | 21 | 8 | 10 | 38 | ||||||||
6 6 | 25 | 4 | 9 | 34 | ||||||||
7 7 | No Ara | -4 | -4 | -6 | -6 | -6 | -6 | -5 | -5 | |||
8 8 | 16 | 17 | 5 | 5 | 10 | 9 | 29 | 28 | ||||
9 9 | 16 | 15 | 2 | 8 | 8 | 7 | 38 | 32 | ||||
10 10 | 17 | 18 | 8 | 6 | 40 | 34 | ||||||
11 11 | T7 | Ara | -3 | -3 | -3 | -1 | -3 | -1 | ||||
12 12 | 12 | 12 | 4 | 22 | 14 | 34 | ||||||
13 13 | 11 | 16 | 5 | 28 | 13 | 37 | ||||||
14 14 | 10 | 8 | 22 | 11 | 36 | |||||||
15 15 | No Ara | -4 | -4 | -5 | -5 | -5 | -5 | -5 | -5 | |||
16 16 | 12 | 6 | 19 | 20 | 22 | 20 | 10 | 9 | ||||
17 17 |