<!DOCTYPE html>
Cleaning factory: methotrexate
Project: Cleaning factory
Authors: iGEM_GO_Paris_saclay
Thursday, 11/7/2019
Aim: We successively induce the expression of the MTX degradation pathway and then of nuclease_gp3 . Thereafter bacteria were incubated in the presence of MTX. We monitored MTX biotransformation by HPLC analysis. MTX should be degrated as if there was no nuclease induction.
For our cleaning factory, our 2 plasmids must not have the same replication origin to not lose one of them. Then, we amplify the replication origin 15A in pZA-15A31 and pZA-15A34 in order to put it in pBAD24 instead of the ColE1. For this, we use the Gibson assembly method.
●
Correction of the replication origin of pZA-15A31 and pZA-15A34 : Marie_Natacha
Nanodrop : (from Philippe's tubes)
pZA-15A31 -> 0,161 ng/µL ; A260 0,0032 ; 260/280 -0,32 ; 260/280 -0,32.
pZA-15A34 -> negative concentration.....
○
PCR protocol :
2,5 µL Ori_15A_F
2,5 µL Ori_15A_R
2 µL pZA-15A31 or pZA-15A34
25 µL Master Mix 2X
18 µL H2O mQ
-> total 50 µL
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-7- Ori_15A_F | GACCTAGGGGATATATTCCGCT | ? |
3 3 | 2019GO-8- Ori_15A_R | GATATCGAGCTCGCTTGGAC | ? |
Primer sequences for changing the replication origin of pZA31 or 34
○
PCR program:
98°C/30sec
25 cycles : 98°C/10sec
65°C/30sec
72°C/30sec
72°C/2min
infinite 15°C
○
agarose 1% gel, 100V 25min. Results :
image.png

○
Heatshock plasmid transformation (Natacha)
Let DH5alpha on ice for 30 min
Add plasmid PZA34 and PZA31M2N (a few µL) in your bacterial solution and let it on ice for 30 min
Heatshock at 42°C for 1 min
Put the solution back in ice for 2 min
Add 1 mL LB (+ Glu) and put the solution at 37°C for 1 h with shaking
Spread out transformants on agar plates (50 µL, 100 µL and 100 µL concentrate)
Put the plates at 37°C overnight
Friday, 12/7/2019
●
Plasmid extraction of pZA31, pZA34 and pSB1C3 : Arnaud
Use of Macherey-Nagel kit "DNA and RNA purification" protocol page 18 "Low copy"
3 extractions per plasmids pZA31 and pZA34 and 2 extractions for pSB1C3
Analysis with Nanodrop :
A A | B B | C C | D D | |
1 1 | Plasmid | ng/uL | 260/230 | 260/280 |
2 2 | pSB1C3 (1) | 52.4 | 2.39 | 2.04 |
3 3 | pSB1C3 (2) | 66.84 | 2.21 | 2.01 |
4 4 | pZA34 (1) | 10.57 | 1.09 | 2.56 |
5 5 | pZA34 (2) | 13.08 | 1.15 | 2.21 |
6 6 | pZA34 (3) | 12.34 | 1.61 | 2.51 |
7 7 | pZA31 (1) | 12.74 | 2.10 | 2.70 |
8 8 | pZA31 (2) | 14.35 | 1.40 | 2.63 |
9 9 | pZA31 (3) | 13.79 | 2.08 | 2.61 |
Table4
●
PCR for Gibson assembly of pBAD24A1/pBAD24_Moclo: Kim
PCR of plasmid pBAD24 with or without the A1 gene.
Expected size : pBAD24_A1 = 5,5 kB
pBAD24_Moclo = 3,9 kB
A1 = 1,6 kB
Primers: pBAD24_F (9) and pBAD24_R (10)
Tm = 62°C
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-9- ori15A_pBAD24_v2_F | gtccaagcgagctcgatatcgagcctatggaaaaacgcca | |
3 3 | 2019GO-10- ori15A_pBAD24 _v2_R | agcggaatatatcccctaggtcgggattttggtcatgagattatc |
Primer sequences for Gibson assembly to remove the replicative origins
Follow the protocol "PCR Q5 HF"
2 reactions per plasmid (50µL)
PCR program:
(30 cycles)
98°C 30 sec
98°C 10 sec
62°C 3 min
72°C 3 min
72°C 2 min
5 µL of each reaction were migrated on agarose 1%. No fragments were detected. The PCR needs to be done again.
Monday, 15/7/2019
●
PCR of pZA31, pZA34, pBAD24_A1 and pBAD24_Moclo : Arnaud_Abdel
For pZA31 and pZA34, Primers : Ori 15 A_F and Ori 15 A_R
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-7- Ori_15A_F | GACCTAGGGGATATATTCCGCT | ? |
3 3 | 2019GO-8- Ori_15A_R | GATATCGAGCTCGCTTGGAC | ? |
Table5
For pBAD24_A1 and pBAD24_Moclo, Primers : pBAD24_F and pBAD24_R
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-9- ori15A_pBAD24_v2_F | gtccaagcgagctcgatatcgagcctatggaaaaacgcca | |
3 3 | 2019GO-10- ori15A_pBAD24 _v2_R | agcggaatatatcccctaggtcgggattttggtcatgagattatc |
Table6
For 1 PCR , Vf = 90 µL
■
2.5 µL per primers 10mM
■
1 µL template
■
25 µL Master Mix (Enzyme, dNTPs, Buffer)
■
18 µL Water
The 4 PCR are done simultaneously with the following program:
I.
98°C - 1 min
II.
98°C - 10 s
III.
62°C - 30 s
IV.
72°C - 165 s
V.
Repeat from step 2 (30 times)
VI.
72°C - 2 min
VII.
8°C - Infinity
The products are analysed by electrophoresis
Gel PCR 15.07.jpg

Wednesday, 17/7/2019
Gibson cloning, substitute replication origin ColE1 with A15 : Hugues
○
Extraction on gel of pBAD24-A1 (without Ori ColE1) with the kit DNA extraction Macherey-Nagel
○
Digestion of template plasmids with DpnI, 0,5µL of enzyme (37°C 1h then 80°C 20min)
○
PCR clean up Macherey-Nagel (elution in 30µL NE buffer)
○
Nanodrop pBAD24-A1(without Ori ColE1) = 1,5 ng/µL
Thursday, 18/7/2019
●
Nanodrop and Gibson assembly of A15 (1) and A15(4) (Kim and Hugues):
1µl DpnI 1h at 37°C. Then 20 minutes at 80°C. PCR clean-up.
Nanodrop concentration:
A15 (1) = 100 ng/µl
A15 (4) = 100 ng/µl
Gibson:
1h with Gibson mix at 50°C. 1:1 ratio --> 4µl of plasmid + 1 µl of (1) and (4) each diluted at 1/10.
●
PCR on plasmid pBAD24-MoClo in order to remove the replication origin: Hugues
PCR protocol:
25µL buffer Q5 2X
2,5µL primer 9
2,5µL primer 10
1µL pBAD24 MoClo
10µL solution Q
9µL H2O
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-9- ori15A_pBAD24_v2_F | gtccaagcgagctcgatatcgagcctatggaaaaacgcca | |
3 3 | 2019GO-10- ori15A_pBAD24 _v2_R | agcggaatatatcccctaggtcgggattttggtcatgagattatc |
Primer sequences for gibson assembly in order to remove the origin of pBAD24-Moclo
PCR program used:
98°C 30sec
98°C 10sec
62°C 20sec *5
72°C 2min
98°C 10sec
72°C 20sec *25
72°C 2min
72°C 2min
Monday, 22/7/2019
●
PCR colony on bacteria transformed with Gibson products : Arnaud
PCR program:
I.
98°C 5min
II.
98°C 30sec
III.
54°C 30sec
IV.
72°C 1min
V.
Repeat from step 2 (30times)
VI.
72°C 10min
VII.
8°C Infinity
PCR protocol :
Vf = 25µL
dXTPs 5 mM 1µL
Oligos (7 et 8) 1µL/oligo
Matrice 1µL
Enzyme DreamTaq 0.5µL
Tampon DreamTaq 10X 2.5µL
H2O 18µL
Results : Analysis on eletrophoresis showed no success with the PCR
●
Gibson : Arnaud
Tomorrow:
DpnI digestion
PCR clean up
Transformation into competent cells
Tuesday, 23/7/2019
PCR for Gibson assembly of pBAD24A1/pBAD24A1 without Ori : Colombe
PCR of plasmid pBAD24A1 with or without the ori.
Expected size : pBAD24_A1 = 5,5 kB = 5575 B
Primers: pBAD24_F (9) and pBAD24_R (10)
Tm = 62°C
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-9- ori15A_pBAD24_v2_F | gtccaagcgagctcgatatcgagcctatggaaaaacgcca | |
3 3 | 2019GO-10- ori15A_pBAD24 _v2_R | agcggaatatatcccctaggtcgggattttggtcatgagattatc |
Primer sequences for gibson assembly in order to remove the origin of pBAD24-Moclo
Follow the protocol "PCR Q5 HF"
2 reactions per plasmid (50µL) : 4 reactions in total
PCR program:
(30 cycles)
98°C 30 sec
98°C 10 sec
62°C 3 min _ 5 cycles
72°C 3 min _ 25 cycles
72°C 5 min
RESULTS :
wells 1 & 2 : pBAD24_A1 with ori => no results because of empty eppendorf ?
wells 3 & 4 : pBAD24_A1 without ori from gel extraction of the previous PCR
IMG_8718.JPG

(5 µL of each reaction were migrated on agarose 1%.)
Then DNA extraction from agarose gel with gel extraction's kit of NucleoSpinR Gel and PCR clean-up, macherey-nagel
Seen NucleoSpin Macherey-Nagel protocol
Wednesday, 31/7/2019
●
PCR pBAD-A1 (without ori colE1) : Laetitia et Mahnaz
Oligos 9 et 10
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-9- ori15A_pBAD24_v2_F | gtccaagcgagctcgatatcgagcctatggaaaaacgcca | |
3 3 | 2019GO-10- ori15A_pBAD24 _v2_R | agcggaatatatcccctaggtcgggattttggtcatgagattatc |
Primer sequences for gibson assembly in order to remove the origin of pBAD24-Moclo (2)
DNA : pBAD24-A1 118ng (nd, PCR1) or 11,8ng (diluted 10x, PCR2) or 1,18ng (diluted 100x, PCR3)
Enz Q5
PCR program :
98°C/30sec
5 cycles : 98°C/10sec
52°C/30sec
72°C/3min
20 cycles : 98°C/10sec
72°C/30sec
72°C/3min
72°C/2min
Results :
Friday, 2/8/2019
●
Gibson Assembly of pBAD-A1 (without origin) with origin 15A : Laetitia
3 assemblies are done. The third one is a negative controle with only the pBAD-A1 without origin PCR fragment
Assembly 1 :
1.
pBAD-A1 without origin PCR fragment 2,5 µL of PCR3 (about 300ng) (for PCR details, see July 31st)
2.
PCR Product origin 15A diluted 7 times 2,5µL
3.
Gibson assembly mix 15 µL
Final volume = 20 µL
Assembly 2 :
1.
pBAD-A1 without origin PCR fragment 2,5 µL of PCR1 (about 300ng) (for PCR details, see July 31st)
2.
PCR Product origin 15A diluted 7 times 2,5µL
3.
Gibson assembly mix 15 µL
Final volume = 20 µL
Assembly 3 (control) :
1.
pBAD-A1 without origin PCR fragment 2,5 µL of PCR1 (about 300ng) (for PCR details, see July 31st)
2.
H2O 2,5µL
3.
Gibson assembly mix 15 µL
Final volume = 20 µL
Then it is put at 50°C for one hour (PCR machine) and store in ice for transformation later on.
●
Heatshock plasmid transformation (with Golden gate and Gibson done above) : Laetitia
1.
50 µL of ultra-competent cells DH5alpha E. coli +
2 µL from Gibson assembly of pBAD-A1 (without origin) with origin 15A n°1 or
2 µL from Gibson assembly of pBAD-A1 (without origin) with origin 15A n°2 or
2 µL from Gibson assembly of pBAD-A1 (without origin) without origin 15A (control) n°3 or
2 µL from Golden Gate of pBADMoclo with A1 and RBS_Rdrp or
2 µL from Golden Gate of pBADMoclo alone (control)
2. 30min on ice
3. Heat shock 90s at 42°C
4. 15min on ice and then add 1mL of LB and put tubes at 37°C for 1h
5. Spread cells on LB+Amp+Glu and cells are incubated at 37°c for 24h
Results :
●
With Gibson products : No colony to be seen on any plate. Transformation didn't work. => Fail
●
With Golden Gate : No colony for the transformants control (pBAD24_A1). Colonies available for the transformants pBAD24_A1_RBS_Rdrp on the plates. => Success
Thursday, 8/8/2019
●
PCR of pBAD24-A1, pBAD24-T7 and pBAD24-MoClo for Gibson assembly (Clara)
Gibson assembly was designed in order to make all our plasmid origins compatible between each of them (pBAD24 and pZA31-Cpg2)
For this PCR the master mix of Q5 was used, for more details, see the protocol "PCR Q5 HF". PCR products have been amplified everywhere except for the Ori part.
The PCR program used was the following:
A A | B B | C C | |
1 1 | STEP | TEMP | TIME |
2 2 | Initial denaturation | 98°C | 30 sec |
3 3 | 35 cycles | 98°C | 30 sec |
4 4 | 60°C | 30 sec | |
5 5 | 72°C | 3 min | |
6 6 | Final extension | 72°C | 10 min |
7 7 | Hold | 4-10°C |
Table1
However, we observed a smear after electrophoresis, so the PCR was done again the next day with diluted DNA.
The photo of this gel wasn't saved.
Friday, 9/8/2019
●
PCR of pBAD24-A1, pBAD24-T7 and pBAD24-MoClo for Gibson assembly (Clara)
Gibson assembly was designed in order to make all our plasmid origins compatible between each of them (pBAD24 and pZA31-Cpg2)
For this PCR the master mix of Q5 was used, for more details, see the protocol "PCR Q5 HF". PCR products have been amplified everywhere except for the Ori part.
The PCR program used was the following:
A A | B B | C C | |
1 1 | STEP | TEMP | TIME |
2 2 | Initial denaturation | 98°C | 30 sec |
3 3 | 5 cycles | 98°C | 30 sec |
4 4 | 60°C | 30 sec | |
5 5 | 72°C | 3 min | |
6 6 | Final extension | 72°C | 10 min |
7 7 | 20 cycles | 98°C | 10 sec |
8 8 | 72°C | 30 sec | |
9 9 | 72°C | 3 min | |
10 10 | Hold | 4-10°C | |
11 11 |
Table2
DNAs were diluted 10 and 100 times pBAD-A1:? and pBAD-MoClo: 118ng/µl) except for pBAD24-T7 (plasmid concentration was 16ng/µl).
Results:
PCR pbadmoclo et pbad A1 T7.pdf
pBAD24-MoClo wasn't amplified, maybe a pipetting error. Have to do the PCR for this plasmid again, the expected size should have been 3946 pb.
Monday, 12/8/2019
●
PCR of pBAD24-MoClo for Gibson assembly (Clara)
Gibson assembly was designed in order to make all our plasmid origins compatible between each of them (pBAD24 and pZA31-Cpg2)
For this PCR the master mix of Q5 was used, for more details, see the protocol "PCR Q5 HF". PCR products have been amplified everywhere except for the Ori part.
The PCR program used was the following:
A A | B B | C C | |
1 1 | STEP | TEMP | TIME |
2 2 | Initial denaturation | 98°C | 30 sec |
3 3 | 5 cycles | 98°C | 30 sec |
4 4 | 60°C | 30 sec | |
5 5 | 72°C | 3 min | |
6 6 | Final extension | 72°C | 10 min |
7 7 | 20 cycles | 98°C | 10 sec |
8 8 | 72°C | 30 sec | |
9 9 | 72°C | 3 min | |
10 10 | Hold | 4-10°C | |
11 11 |
Table3