Team:Freiburg/Labbook/In Vivo

Judging Form  
Achievements
Software
Model
Lab Book: Expression

Click on an item for a detailed description

Droplet cloning and characterization

04.06.19

- Made 1:10 dilutions of all primers 

Primers    Cloning of Droplet forming proteins    TM °C Ta °C
           
Name Tube name Sequence (overlap/spacer/ANNEAL) Use    
pBAD33_fwd pBAD33_sfGFP_gibson_f gctctacaaaTAAATCGATCGCGTTAGG Gibson primer to join sfGFP and the start of the pBAD33 Backbone ( 58.5 56.1
pBAD33_rev pBAD_FUS_gibson_rev tagacgccatGCTAGCATTATACCTAGG Gibson primer to join FUS and the end of pBAD33 Backbone 55.1 56.1
FUS_fwd FUS_pBAD33_gibson_fw taatgctagcATGGCGTCTAATGACTACACTCAGC Gibson primer to join FUS and the end of pBAD33 Backbone (reverse) 68.3 69.3
FUS_rev FUS_sfGFP_gibson_rev cggatcctccGTATGGGCGCTCGCGACG Gibson primer to join FUS and the sfGFP with linker(reverse) 72.4 69.3
linker_spGFP_fwd gsGFP_pBAD33_gibson_f gcgcccatacGGAGGATCCGGAGGATCC Joins the start of sfGFP to the end of fus 67.0 65.6
linker_spGFP_rev spGFP_pBAD33_gibson_r gatcgatttaTTTGTAGAGCTCATCCATGCC Gibson primer to join sfGFP and the start of the pBAD33 Backbone 64.6 65.6
           
SPD5          
pBAD33_fwd pBAD_SPD5_fwd gctctacaaaTAAATCGATCGCGTTAGG Gibson primer to join stGFP and the start of the pBAD33 Backbone 58.5 56.1
pBAD33_rev pBAD33_SPD5_gibson_rev tatcttccatGCTAGCATTATACCTAGG  Gibson primer to join stGFP and the start of the pBAD33 Backbone (reverse) 55.1 56.1
SPD5_1_fwd SPD5_pBAD33_gibson_fwd taatgctagcATGGAAGATAACTCTGTCCTTAATGAAG Gibson primer to join SPD5_1 at the end of pBAD33 63.5 64.5
SPD5_1_rev SPD5_1_gibson_rev gtgcaatagtGAAACGACGCGACGCTTC Gibson primer to join SPD5_1 at the end of pBAD33 (reverse) 67.2 64.5
SPD5_2_fwd SPD5_2_gibson_fw gcgtcgtttcACTATTGCACCGGATGCTG Gibson primer to join SPD5_2 at the end of SPD5_1 65.2 62.6
SPD5_2_rev SPD5_2_sfGFP_gibson_rev cggatcctccCTTCTTGCGAATTTCCTTTACG Gibson primer to join SPD5_2 at the end of SPD5_1 (reverse) 61.6 62.6
linker_spGFP_fwd sfGFP_SPD5_2_gibson_fw tcgcaagaagGGAGGATCCGGAGGATCC Forward primer for sfGFP (at the end of SPD5) 67.0 65.6
linker_spGFP_rev sfGFP_pBAD33_gibson_rev gatcgatttaTTTGTAGAGCTCATCCATGCC Reverse primer GFP at the start of pBAD 64.6 65.6
mCherry          
pBAD33_fwd PBAD33_mCherry_gibson_fwd cgagctgtacTAAATCGATCGCGTTAGG Gibson primer to join mCHERRY and the start of the PBAD33 Backbone 58.5 56.1
pBAD33_rev pBAD_EWSR1_gibson_rev ttgaggccatGCTAGCATTATACCTAGG Gibson primer to join mCHERRY and the start of the PBAD33 Backbone (reverse) 55.1 56.1
EWSR1_fwd EWSR1_pBAD33_gibson_fwd                                                 taatgctagcATGGCCTCAACTGACTACTC Gibson primer to join EWSR1 and the end of the PBAD33 Backbone 63.7 64.7
EWSR1_rev EWSR1_mCherry_gibson_rev                                    ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG Gibson primer to join EWSR1 and the end of the PBAD33 Backbone (reverse) 67.1 64.7
GS_mCherry_fwd mCherry_EWSR1_gibson_fwd                                    tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG Gibson primer to join mCHERRY and the end of the EWSR1 68.8 66.9
GS_mCherry_rev mCherry_pBAD33_gibson_rev                                                     gatcgatttaGTACAGCTCGTCCATGCC Gibson primer to join mCHERRY and the end of the EWSR1 (reverse) 65.9 66.9
           
           
           
NiCD          
pBAD33_fwd pBAD33_sfGFP_gibson_fwd                                          tgagctctacaaaTAAATCGATCGCGTTAGGC Gibson primer to join sfGFP and the start of the PBAD33 Backbone 57.1 60.4
pBAD33_rev pBAD33_NICD_gibson_rev                                      tgacgcattcatGCTAGCATTATACCTAGGACTG Gibson primer to join sfGFP and the start of the PBAD33 Backbone (reverse) 56.9 60.4
NICD_fwd NICD_pBAD33_gibson_fwd                                    gtataatgctagcATGAATGCGTCATGTGTAGGGG Gibson primer to join NICD at the end of pBAD33 62.5 65.6
NICD_rev NICD_sfGFP_rev                         ctcctttgctcatggatcctccggatcctccGACCAGATGGCCGCGCAG Gibson primer to join NICD at the end of pBAD33 (reverse) 65.7 65.6
sfGFP_fwd sfGFP_NICD_fwd                       ggccatctggtcggaggatccggaggatccATGAGCAAAGGAGAAGAACTTTTC Gibson primer to join sfGFP at the end of NCID 59.1 60.8
sfGFP_rev sfGFP_pBAD33_rev                                       gcgatcgatttaTTTGTAGAGCTCATCCATGC Gibson primer to join sfGFP at the end of NCID (reverse) 57.3

60.8

 

Ordered gBlocks sequences:

EWSR1 (Ewing Sarcoma Breakpoint Region 1):

 atggcctcaactgactactccacttactcgcaggcagcagcacagcaaggctacagcgcttatacagcccagccaacgcaaggatatgcccaaacaacgcaggcatacggtcagcagtcttacggcacttacggccagccaactgatgtctcttacactcaagctcagaccacagcgacttatggccagaccgcatatgccacctcttacggtcagcccccgaccgtggaaggaacgtcgactggctatacaactccaaccgctcctcaagcatacagccagccagtccaaggatatggaaccggtgcatacgatacaacaactgccacagtgacgactacacaggcttcttatgcagctcagagtgcatatgggactcaaccagcatacccggcatacggccagcagccagctgcaacagctccaacgcgtcctcaggatggcaacaagccaacagagacctcgcaaccccagtccagtacaggtggctacaatcagccctccttggggtatgggcagagtaactactcgtacccccaagtccccggttcttaccctatgcagcctgtcacggcgcccccgagctatccacctacctcctatagcagtacgcagcccacgtcatatgatcagtcctcatattcccagcaaaacacatatgggcaacctagcagttatggccagcagtcttcgtacgggcagcagtcatcgtatggacagcaacctccgacatcatatccaccacagaccggatcgtactctcaggcaccatcacaatattctcagcaatcatcgtcatacggtcagcagtcttcttttcgtcaggatcatccttcttcgatgggtgtatatggccaagaatcggggggattctctggaccgggtgagaaccgtagtatgtcaggcccagacaaccgtggccgtggtcgtggcggtttcgatcgtggtggcatgtcgcgcggtgggcgtggtgggggccgcgggggtatgggggcaggggagcgtggtgggtttaacaaaccaggtggaccgatggatgagggcccagatcttgacttgggtccaccagtcgatccggatgaggattcagacaatagtgcaatttacgtgcaggggttaaatgactccgtgacgctggatgatctggccgatttcttcaaacaatgcggcgtagtaaaaatgaataaacgcacaggtcaacccatgattcatatctacttggacaaagagactggcaaaccaaaaggagacgctacggtatcatatgaggaccctccaacagctaaagccgctgttgagtggtttgatggaaaagacttccagggaagcaaattaaaggtatcattagcgcgtaaaaaaccacctatgaactcaatgcgcggcggactgccgccccgcgaaggtcgtggtatgccaccgccacttcgtggaggacctggaggtccaggaggtccaggtggtcctatgggacgaatgggaggtcgtggcggcgaccgcgggggttttcctccgcgcgggccccgtggtagtcgtggtaacccttcagggggcggcaacgtgcaacatcgcgcaggcgattggcagtgtccaaacccgggttgcggtaatcagaacttcgcgtggcgtacagaatgtaatcagtgcaaagcgccaaaaccagaaggttttcttccacccccgtttccacctccaggcggagaccgtggccgtggagggccgggtggtatgcgcggcggacgcggaggtcttatggatcgcggtggtccgggcgggatgtttcgtgggggtcgcggcggggatcgtggaggtttccgcggaggtcgcggaatggatcgtggcggattcggaggaggacgtcgtggtggtccaggggggcctcctggtcctctgatggagcagatgggagggcgccgcggtggtcgtggcgggccaggcaagatggataaaggtgagcaccgtcaagagcgccgtgatcgtccctatggaggatccggaggatcc

FUS:

atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac

NICD (Nephrin Intracellular Domain)

atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc

SPD5:

atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag

Created Plasmids in first cloning phase      
  Backbone  Insert Insert Promoter Resistance
P1 pBAD33 EWSR1 mCherry J23119 Chloramphenicol
P2 pBAD33 FUS sfGFP J23119 Chloramphenicol
P3 pBAD33 SPD5 sfGFP J23119 Chloramphenicol
P4 pBAD33 NICD sfGFP J23119 Chloramphenicol
Plasmid 3 with split SPD5 gBlock due to its size. Linker for sfGFP is 2xGGS.
Plasmid 2 with Fus. Linker for the sfGFP is 2xGGS
Plasmid 1 with EWSR1. Linker for mCherry is also 2xGGS.
Plasmid 4 with NICD. Linker for sfGFP is 2xGGS

 

 

Labbook 05.06.2019

Performed amplifications of the Backbones (all Plasmids will be constructed with a pBAD33 backbone), sfGFP and mCherry genes from plasmids.

Following PCR constructs were made:

For FUS:             (A) pBAD amplification with Primers 1&2* (not successful)

                            (B) sfGFP amplification with Primers 5&6*

For SPD5:          (D) pBAD amplification with Primers 7&8* (not successful)

                            (E) sfGFP amplification with Primers 13&14* (not successful)

For EWSR1:       (H) pBAD amplification with Primers 15&16*

                            (I) mCherry amplification with primers 19&20*

*For sequences of primers and roteins see Protocol from Day 04.06.2019

PCR tubes contained:    2,5 μl of each primer (diluted 1:10)

                                        1 μl DNA

                                        19 μl H2O

                                        25 μl Phusion Flash Master Mix (Thermo Fisher Scientific)

Fragments B, H and I were successfully amplified, identified via Gel electrophoresis and purified.

Pic1

Pic2

 

PCR for DNA fragments A, D and E were set up again. To troubleshoot the PCRS, higher Backbone concentrations of about 2 ng were used. Also for fragment E, 3% of DMSO were added to the PCR mix. Also, two different Polymerases were used (Q5 and Phusion Flash).

Furthermore, constructs amplifying pBAD33 (A and D) were incubated overnight with 0,5μl DPN1 enzyme at 37°C to digest methylated bacterial DNA.

All amplifications and purifications were successful. Unfortunately, the PCR image has been lost because of technical issues with the GelViewer.

 

NICD (Nephrin Intracellular Domain) was amplified, as well as sfGFP and pBAD33 with respective overlaps. 

Following PCRS were set up: 

(J) pBAD amplification with primers 1&22*

(K) sfGFP amplification with primers 25&6*

(L) NICD amplification with primers 23&24*

*For all sequences see table in protocol from 04.06.2019

All amplifications were successful, see picture below.

Afterwards, gibson cloning was set up. Considering sizes, amound of insert for 50 ng backbone was calculated.

NICD: 17.6 ng

sfGFP: 24 ng

The DNA was diluted with water until reaching 5 microliters of volume and mixed in a 1:1 ratio with a HiFi ligase/exoniuclease mastermix and incubated at 50°C for 15 minutes. Afterwards competent Top10 E. Coli were transformed with 2 microlitres of Gibson Assembly Mix and incubated overnight. 

After transformation of NICD was ineffective, proportions were calculated again and ligation was repeated. Incubation overnight follows.

Furthermore, gBlocks for EWSR1, FUS, SPD5_1 and SPD5_2 were amplified to create overlaps with following