Team:Freiburg/Labbook/In Vivo

Lab Book: Expression

Click on an item for a detailed description

Droplet cloning and characterization

04.06.19

- Made 1:10 dilutions of all primers 

Primers    Cloning of Droplet forming proteins    TM °C Ta °C
           
Name Tube name Sequence (overlap/spacer/ANNEAL) Use    
pBAD33_fwd pBAD33_sfGFP_gibson_f gctctacaaaTAAATCGATCGCGTTAGG Gibson primer to join sfGFP and the start of the pBAD33 Backbone ( 58.5 56.1
pBAD33_rev pBAD_FUS_gibson_rev tagacgccatGCTAGCATTATACCTAGG Gibson primer to join FUS and the end of pBAD33 Backbone 55.1 56.1
FUS_fwd FUS_pBAD33_gibson_fw taatgctagcATGGCGTCTAATGACTACACTCAGC Gibson primer to join FUS and the end of pBAD33 Backbone (reverse) 68.3 69.3
FUS_rev FUS_sfGFP_gibson_rev cggatcctccGTATGGGCGCTCGCGACG Gibson primer to join FUS and the sfGFP with linker(reverse) 72.4 69.3
linker_spGFP_fwd gsGFP_pBAD33_gibson_f gcgcccatacGGAGGATCCGGAGGATCC Joins the start of sfGFP to the end of fus 67.0 65.6
linker_spGFP_rev spGFP_pBAD33_gibson_r gatcgatttaTTTGTAGAGCTCATCCATGCC Gibson primer to join sfGFP and the start of the pBAD33 Backbone 64.6 65.6
           
SPD5          
pBAD33_fwd pBAD_SPD5_fwd gctctacaaaTAAATCGATCGCGTTAGG Gibson primer to join stGFP and the start of the pBAD33 Backbone 58.5 56.1
pBAD33_rev pBAD33_SPD5_gibson_rev tatcttccatGCTAGCATTATACCTAGG  Gibson primer to join stGFP and the start of the pBAD33 Backbone (reverse) 55.1 56.1
SPD5_1_fwd SPD5_pBAD33_gibson_fwd taatgctagcATGGAAGATAACTCTGTCCTTAATGAAG Gibson primer to join SPD5_1 at the end of pBAD33 63.5 64.5
SPD5_1_rev SPD5_1_gibson_rev gtgcaatagtGAAACGACGCGACGCTTC Gibson primer to join SPD5_1 at the end of pBAD33 (reverse) 67.2 64.5
SPD5_2_fwd SPD5_2_gibson_fw gcgtcgtttcACTATTGCACCGGATGCTG Gibson primer to join SPD5_2 at the end of SPD5_1 65.2 62.6
SPD5_2_rev SPD5_2_sfGFP_gibson_rev cggatcctccCTTCTTGCGAATTTCCTTTACG Gibson primer to join SPD5_2 at the end of SPD5_1 (reverse) 61.6 62.6
linker_spGFP_fwd sfGFP_SPD5_2_gibson_fw tcgcaagaagGGAGGATCCGGAGGATCC Forward primer for sfGFP (at the end of SPD5) 67.0 65.6
linker_spGFP_rev sfGFP_pBAD33_gibson_rev gatcgatttaTTTGTAGAGCTCATCCATGCC Reverse primer GFP at the start of pBAD 64.6 65.6
mCherry          
pBAD33_fwd PBAD33_mCherry_gibson_fwd cgagctgtacTAAATCGATCGCGTTAGG Gibson primer to join mCHERRY and the start of the PBAD33 Backbone 58.5 56.1
pBAD33_rev pBAD_EWSR1_gibson_rev ttgaggccatGCTAGCATTATACCTAGG Gibson primer to join mCHERRY and the start of the PBAD33 Backbone (reverse) 55.1 56.1
EWSR1_fwd EWSR1_pBAD33_gibson_fwd                                                 taatgctagcATGGCCTCAACTGACTACTC Gibson primer to join EWSR1 and the end of the PBAD33 Backbone 63.7 64.7
EWSR1_rev EWSR1_mCherry_gibson_rev                                    ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG Gibson primer to join EWSR1 and the end of the PBAD33 Backbone (reverse) 67.1 64.7
GS_mCherry_fwd mCherry_EWSR1_gibson_fwd                                    tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG Gibson primer to join mCHERRY and the end of the EWSR1 68.8 66.9
GS_mCherry_rev mCherry_pBAD33_gibson_rev                                                     gatcgatttaGTACAGCTCGTCCATGCC Gibson primer to join mCHERRY and the end of the EWSR1 (reverse) 65.9 66.9
           
           
           
NiCD          
pBAD33_fwd pBAD33_sfGFP_gibson_fwd                                          tgagctctacaaaTAAATCGATCGCGTTAGGC Gibson primer to join sfGFP and the start of the PBAD33 Backbone 57.1 60.4
pBAD33_rev pBAD33_NICD_gibson_rev                                      tgacgcattcatGCTAGCATTATACCTAGGACTG Gibson primer to join sfGFP and the start of the PBAD33 Backbone (reverse) 56.9 60.4
NICD_fwd NICD_pBAD33_gibson_fwd                                    gtataatgctagcATGAATGCGTCATGTGTAGGGG Gibson primer to join NICD at the end of pBAD33 62.5 65.6
NICD_rev NICD_sfGFP_rev                         ctcctttgctcatggatcctccggatcctccGACCAGATGGCCGCGCAG Gibson primer to join NICD at the end of pBAD33 (reverse) 65.7 65.6
sfGFP_fwd sfGFP_NICD_fwd                       ggccatctggtcggaggatccggaggatccATGAGCAAAGGAGAAGAACTTTTC Gibson primer to join sfGFP at the end of NCID 59.1 60.8
sfGFP_rev sfGFP_pBAD33_rev                                       gcgatcgatttaTTTGTAGAGCTCATCCATGC Gibson primer to join sfGFP at the end of NCID (reverse) 57.3

60.8

 

Ordered gBlocks sequences:

EWSR1 (Ewing Sarcoma Breakpoint Region 1):

 atggcctcaactgactactccacttactcgcaggcagcagcacagcaaggctacagcgcttatacagcccagccaacgcaaggatatgcccaaacaacgcaggcatacggtcagcagtcttacggcacttacggccagccaactgatgtctcttacactcaagctcagaccacagcgacttatggccagaccgcatatgccacctcttacggtcagcccccgaccgtggaaggaacgtcgactggctatacaactccaaccgctcctcaagcatacagccagccagtccaaggatatggaaccggtgcatacgatacaacaactgccacagtgacgactacacaggcttcttatgcagctcagagtgcatatgggactcaaccagcatacccggcatacggccagcagccagctgcaacagctccaacgcgtcctcaggatggcaacaagccaacagagacctcgcaaccccagtccagtacaggtggctacaatcagccctccttggggtatgggcagagtaactactcgtacccccaagtccccggttcttaccctatgcagcctgtcacggcgcccccgagctatccacctacctcctatagcagtacgcagcccacgtcatatgatcagtcctcatattcccagcaaaacacatatgggcaacctagcagttatggccagcagtcttcgtacgggcagcagtcatcgtatggacagcaacctccgacatcatatccaccacagaccggatcgtactctcaggcaccatcacaatattctcagcaatcatcgtcatacggtcagcagtcttcttttcgtcaggatcatccttcttcgatgggtgtatatggccaagaatcggggggattctctggaccgggtgagaaccgtagtatgtcaggcccagacaaccgtggccgtggtcgtggcggtttcgatcgtggtggcatgtcgcgcggtgggcgtggtgggggccgcgggggtatgggggcaggggagcgtggtgggtttaacaaaccaggtggaccgatggatgagggcccagatcttgacttgggtccaccagtcgatccggatgaggattcagacaatagtgcaatttacgtgcaggggttaaatgactccgtgacgctggatgatctggccgatttcttcaaacaatgcggcgtagtaaaaatgaataaacgcacaggtcaacccatgattcatatctacttggacaaagagactggcaaaccaaaaggagacgctacggtatcatatgaggaccctccaacagctaaagccgctgttgagtggtttgatggaaaagacttccagggaagcaaattaaaggtatcattagcgcgtaaaaaaccacctatgaactcaatgcgcggcggactgccgccccgcgaaggtcgtggtatgccaccgccacttcgtggaggacctggaggtccaggaggtccaggtggtcctatgggacgaatgggaggtcgtggcggcgaccgcgggggttttcctccgcgcgggccccgtggtagtcgtggtaacccttcagggggcggcaacgtgcaacatcgcgcaggcgattggcagtgtccaaacccgggttgcggtaatcagaacttcgcgtggcgtacagaatgtaatcagtgcaaagcgccaaaaccagaaggttttcttccacccccgtttccacctccaggcggagaccgtggccgtggagggccgggtggtatgcgcggcggacgcggaggtcttatggatcgcggtggtccgggcgggatgtttcgtgggggtcgcggcggggatcgtggaggtttccgcggaggtcgcggaatggatcgtggcggattcggaggaggacgtcgtggtggtccaggggggcctcctggtcctctgatggagcagatgggagggcgccgcggtggtcgtggcgggccaggcaagatggataaaggtgagcaccgtcaagagcgccgtgatcgtccctatggaggatccggaggatcc

FUS:

atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac

NICD (Nephrin Intracellular Domain)

atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc

SPD5:

atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag

Created Plasmids in first cloning phase      
  Backbone  Insert Insert Promoter Resistance
P1 pBAD33 EWSR1 mCherry J23119 Chloramphenicol
P2 pBAD33 FUS sfGFP J23119 Chloramphenicol
P3 pBAD33 SPD5 sfGFP J23119 Chloramphenicol
P4 pBAD33 NICD sfGFP J23119 Chloramphenicol
Plasmid 3 with split SPD5 gBlock due to its size. Linker for sfGFP is 2xGGS.
Plasmid 2 with Fus. Linker for the sfGFP is 2xGGS
Plasmid 1 with EWSR1. Linker for mCherry is also 2xGGS.
Plasmid 4 with NICD. Linker for sfGFP is 2xGGS

 

 

Labbook 05.06.2019

Performed amplifications of the Backbones (all Plasmids will be constructed with a pBAD33 backbone), sfGFP and mCherry genes from plasmids.

Following PCR constructs were made:

For FUS:             (A) pBAD amplification with Primers 1&2* (not successful)

                            (B) sfGFP amplification with Primers 5&6*

For SPD5:          (D) pBAD amplification with Primers 7&8* (not successful)

                            (E) sfGFP amplification with Primers 13&14* (not successful)

For EWSR1:       (H) pBAD amplification with Primers 15&16*

                            (I) mCherry amplification with primers 19&20*

*For sequences of primers and roteins see Protocol from Day 04.06.2019

PCR tubes contained:    2,5 μl of each primer (diluted 1:10)

                                        1 μl DNA

                                        19 μl H2O

                                        25 μl Phusion Flash Master Mix (Thermo Fisher Scientific)

Fragments B, H and I were successfully amplified, identified via Gel electrophoresis and purified.

Pic1

Pic2

 

PCR for DNA fragments A, D and E were set up again. To troubleshoot the PCRS, higher Backbone concentrations of about 2 ng were used. Also for fragment E, 3% of DMSO were added to the PCR mix. Also, two different Polymerases were used (Q5 and Phusion Flash).

Furthermore, constructs amplifying pBAD33 (A and D) were incubated overnight with 0,5μl DPN1 enzyme at 37°C to digest methylated bacterial DNA.

All amplifications and purifications were successful. Unfortunately, the PCR image has been lost because of technical issues with the GelViewer.

 

NICD (Nephrin Intracellular Domain) was amplified, as well as sfGFP and pBAD33 with respective overlaps. 

Following PCRS were set up: 

(J) pBAD amplification with primers 1&22*

(K) sfGFP amplification with primers 25&6*

(L) NICD amplification with primers 23&24*

*For all sequences see table in protocol from 04.06.2019

All amplifications were successful, see picture below.

Afterwards, gibson cloning was set up. Considering sizes, amound of insert for 50 ng backbone was calculated.

NICD: 17.6 ng

sfGFP: 24 ng

The DNA was diluted with water until reaching 5 microliters of volume and mixed in a 1:1 ratio with a HiFi ligase/exoniuclease mastermix and incubated at 50°C for 15 minutes. Afterwards competent Top10 E. Coli were transformed with 2 microlitres of Gibson Assembly Mix and incubated overnight. 

After transformation of NICD was ineffective, proportions were calculated again and ligation was repeated. Incubation overnight follows.

Furthermore, gBlocks for EWSR1, FUS, SPD5_1 and SPD5_2 were amplified to create overlaps with following Primers:

EWSR1 with Primers 17 and 18*

FUS with Primers 3 and 4*

SPD5_1 and SPD5_2 with Primers 9&10 and 11&12 respectively*

*For primer and protein sequences see protocol from 04.06.2019.

Amplification was only successful for SPD5_2 in the first round:

<

PCR troubleshooting consisted of repeating the reaction with two different polymerases, being Q5 and Phusion Flash, as well as adding 3% DMSO to the DNA mix. In the case of EWSR1, DNA was increased to 2 ng.

In the second round, bands for each sequence could be seen, were cut and purified. 

12.06.19

Transformation from the day before was unsuccessful, no colonies were on the plate. We found out we used Ampicillin plates, which is the wrong antibiotic.

Since all required sequences for the designed plasmids (for more information about plasmid constructs see protocol from day 04.06.2019) were now amplified, ligation for all plasmids could now start. The method used was Gibson Cloning. The gibson assemblies were then plated on Chloramphenicol plates and incubated overnight.

13.06.19

Gibson assembly of the Plasmids containing NICD and SPD5, EWSR.

Following constructs were ligated with NEB HiFi Ligase:

Fus:  A + B + C (Fus)

EWSR1: H, I, J (EWSR1)

SPD5: D, E, F(SPD5_1) and G (SPD5_2)

Together with the ligated NICD plasmid, all plasmids were transformed into competent E. Coli and plated on chloramphenicol plates.

Plates were incubated overnight at 37°C

14.06.19

Plates containing FUS, SPD5 and NICD from 13.06.2019 had colonies. EWSR1 had no colonies.

Coloies were picked and LB medium with Chloramphenicol was inoculated, bacteria was grown in media for 5 hours and prepared for sequencing. 

A second set of media were incoulated and prepared for microscopy. Samples were visualized with a Widefield microscope and analyzed with FiJi. Images attached.

 

SPD5 sample 2: Dispersed fluroescence (left). No indication for droplets found.

SPD5 sample 1. Lighter spots that can be an indication for droplets in the fluorescent image (Left) that are not visible on the right.

FUS sample 1. Low, dispersed fluorescence (left). No indications for droplets.

NICD sample 1. Low, dispersed fluorescence (left). No indications for droplets.

Problem with NICD: A cloning mistake has led to an excessive atg start codon at the begining of sfGFP, which may give misleading results.

Complementary primers for a site directed mutagenesis deleting the excessive three bases were ordered. 

Criteria for identifying if an accumulation of fluorescent proteins are dynamic droplets or dead aggregates:

1. They appear in a concentration dependent manner,

2. They fuse when they encounter another one of their kind,

3. Fluorescence regeneraties after photobleaching (FRAP)

In order to determine whether the results seen in the last protocol are significant, the constructed proteins have to be inducible to be seen under different concentrations.

Cloning steps were repeated so that the constructs could be positioned in front of inducible promoters. Additionally, EWSR1 will be inserted in a different backbone with

compatible origins of replications with the pBAD backbone, so that FUS and EWSR1 can be induced in the same bacteria without competition. The new backbone for 

EWSR1 is pTrc99a (empty) with a prc promoter.

Following primers are now added to the list:

New primers        
Number Name Tube name Sequence Description
31 pBAD33wt_SPD5_FWD pBAD33wt_SPD5_FWD TGGATGAGCTCTACAAATAAAAGCTTGGCTGTTTTGGCGG  Primer to amplify new pBAD33(induceable promoter) with right overlaps
32 pBAD33wt_SPD5_REV pBAD33wt_SPD5_REV AGGACAGAGTTATCTTCCATTCTAGAGGATCCCCGGGTAC  Primer to amplify new pBAD33(induceable promoter) with right overlaps
32_2 SPD5_1_mid_GFP_rev SPD5_1_mid_GFP_rev GTGCAATAGTGAAACGACGCGACGC  
33 SPD5_sfGFP_pBAD33 FWD SPD5_sfGFP_pBAD33 FWD GTACCCGGGGATCCTCTAGAATGGAAGATAACTCTGTCCTTAA  Primer to amplify SPD5_1 with the right overlap for new backbone
34 SPD5_sfGFP_pBAD33 REV SPD5_sfGFP_pBAD33 REV CCGCCAAAACAGCCAAGCTTTTATTTGTAGAGCTCATCCATGC  Primer to amplify GFP with the right overlap for new backbone
35 EWSR1_mCherry_pBAD33 FWD EWSR1_mCherry_pBAD33 FWD CATGGAATTCGAGCTCGGTAATGGCCTCAACTGACTACTC Primer to amplify EWSR1 with the right overlap for new backbone
36 EWSR1_mCherry_pBAD33 REV EWSR1_mCherry_pBAD33 REV GACTCTAGAGGATCCCCGGGTTAGTACAGCTCGTCCATGC  Primer to amplify mCherry with the right overlap for new backbone
37  pTrc99A FWD  pTrc99A FWD GCATGGACGAGCTGTACTAACCCGGGGATCCTCTAGAGTC Primer to amplify pTrc99A (induceable promoter) with right overlaps
38 pTrc99A REV pTrc99A REV GAGTAGTCAGTTGAGGCCATTACCGAGCTCGAATTCCATG  Primer to amplify pTrc99A (induceable promoter) with right overlaps
39 NICD_sfGFP_pBAD33_FWD NICD_sfGFP_pBAD33_FWD GTACCCGGGGATCCTCTAGAATGAATGCGTCATGTGTAGG  Primer to amplify NICD with the right overlap for new backbone
39_2 NICD_mid_sfGFP_REV NICD_mid_sfGFP_REV TCCTTTGCTCATGGATCCTCCGGATCCTC Primer to amplify NICD with the right overlap for new backbone
40 NICD_sfGFP_pBAD33 REV NICD_sfGFP_pBAD33 REV CCGCCAAAACAGCCAAGCTTTTATTTGTAGAGCTCATCCATGC  Primer to amplify sfGFP with the right overlap for new backbone
41 pBAD33wt_NICD FWD pBAD33wt_NICD FWD TGGATGAGCTCTACAAATAAAAGCTTGGCTGTTTTGGCGG  Primer to amplify new pBAD33(induceable promoter) with right overlaps
42 pBAD33wt_NICD REV pBAD33wt_NICD REV CCTACACATGACGCATTCATTCTAGAGGATCCCCGGGTAC  Primer to amplify new pBAD33(induceable promoter) with right overlaps
         
  Primers for NICD atg deletion    
         
  atg_del_fwd GATCCGGAGGATCCAGCAAAGGAGAAGAAC    
  atg_del_Rev GTTCTTCTCCTTTGCTGGATCCTCCGGATC     

 

Constructs cotnaining the backbone with inducible promoters will be the following:

FUS, containing the following fragments

XA pBAD w/primers 29&30 68°C
XB GFP w/ primers 5&28 63°C
XC FUS w/ primers 27&4 68°C

 

SPD5, containing the following fragments

XD pBAD w/primers 31&32 68°C
XE GFP w/primers 13&34 63°C
XF SPD1 w/primers 33&10 60°C
G SPD2    

EWSR1, containing the following fragments:

XG pBAD w/primers 37&38 65°C
XH EWSR1 w/primers 35&18 65°C
XI mCherry w/primers 19&36 65°C

NICD, containing the following fragments:

XJ pBAD w/primers 41&42 68°C
XK sfGFP w/primers 25&40 63°C
XL NICD w/primers 39&24 63°C

 

Amplifications for the gibson fragments with corrresponding sticky ends were started in order to achieve plasmids with the constructs in front of inducible promoters.

Image left and right: 1% agarose gel with results of amplification of gibson fragments. 

All Fragments except EWSR1 gBlock could be successfully amplified. New primers were ordered as part of the troubleshooting procedure. 

The new primers are:

43 pTrc99a_rev pTrc99a_inducible_rev,  ttgaggccatTACCGAGCTCGAATTCCATG
44 EWSR1_fwd EWSR1_inducible_fwd, gagctcggtaATGGCCTCAACTGACTACTC
45 EWSR1_rev EWSR1_inducible_rev ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG
46 mCherry_fwd mCherry_inducible_fwd tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG
47 mCherry_rev mCherry_inducible_rev, gatccccgggGTACAGCTCGTCCATGCC
48 pTrc99a_fwd pTrc99a_inducible_fwd cgagctgtacCCCGGGGATCCTCTAGAG

 

 

Labbook

25/6/19

Repeat PCR for SPD5_1 and FUS and NICD with new primers and extract from agarose gel.

Transform into competent cells and grow overnight culture.

26/6/19

Planning of FRAP experiment

Widefield and Brightfield microscopy of samples

Gibson assembly of  FUSinducible (XA, XB, XC)

50 ng of Backbone (1uL)

50 ng sfGFP (2,78 uL)

73 ng FUS (0.73 uL)

Retransformation of bacteria with correctly sequenced constructs (constitutive)

Repeat PCR for NICD and SPD5 fragments

27/6/19

Miniprep of assembled FUS

Repeat PCR of fragments XC, XF, XL, XH and HI (not successful except XC, XF)

Repeat PCR of fragments XH XI and XL with 3% DMSO

Gibson assembly of NICD and  SPD5 with correct amplified fragments.

NICD: 50 ng Backbone (0,63 uL)

23,86 ng sfGFP (2,06 uL)

51,14 ng NICD (2,60 uL)

SPD5: 50 ng Backbone (2.5 uL)

sfGFP: 24,68 ng (1,1 uL)

SPD5_1: 68,18 (4,54 uL)

SPD5_2: 51,14 (1,17 uL)

 

 

 

2/7/19

PCR of EWSR1 with primers 17&18, 18&35 and 44&45 in order to amplify EWSR1 constitutive and EWSR1 inducible (twice)

PCR was not successful. Next step is a Touchdown PCR starting at 75°C and going down to 65°C (annealing temperature of the three constructs)

Induceable constructs were retransformed (NICD was made again by Gibson assembly)

Constitutive constructs were retransformed. All retranformations were plated on Chloramphenicol plates and placed overnight in the 37°C incubator.

 

3/7/19

Colonies were picked and new overnight cultures were prepared from the retransformation of the constructs (induceable and constitutive) for the FRAP experiment.

New Glycerol stocks from all constructs were frozen at -80°C

Glucose free TB medium was mixed, heated and autoclaved in order to prepare the induction and FRAP experiment.

New Chloramphenicol plates were made (LB medium + 400uL 34g/mol Chloramphenicol stock solution added at 50°C)

 

 

4/7/19

Microscopy of the working constructs (constitutive FUS, NICD and SPD5 as well as Arbinose-inducible FUS, NICD and SPD5) and the negative control IPTG-inducible

mini eYFP which is known to form aggregates at high concentrations (source: AG Di Ventura, BIOSS Freiburg).

Induction was carried out with the following concentrations:

No induction: E. coli carrying plasmids were grown overnight in TB, diluted to OD 0.01 in the morning, grown to OD 0.5 and further incubated for 2h at 37°C with vigorous shaking.

Induction: E. coli were grown in overnight culture in TB medium, diluted to OD 0.01 in the morning, grown to OD 0.5 and induced with the following concentrations of Arabinose:

LOW: 0.001% Arabinose

MID: 0.05% Arabinose

HIGH: 1% Arabinose

After 2h in the incubater at 37°C and vigorous shaking, miscroscopy was carried out.

At first, samples were analysed with brightfield and widefield GFP microscopy. Cells were checked for droplet like dots.

Most cells didn’t show droplet-like structures, only constitutive SPD5 (as already shown before). Induction seemed to not have worked, since the positive control

plasmid mini eYFP did not show the expected results. Furthermore, general fluorescence of mid and high induced cells was not to be distinguished from low induced cells in most cases.

The constitutive SPD5 probe containing droplet-like structures was analysed under the confocal microscope at 100x. Bleaching was done with 100% laser

intensity with an itinerary of 20. Single droplet like structures were bleached and the Region of Interest (ROI) was analysed, while other ROIs were only analised.

Results did not seem to be clear. Induceable constructs are analysed (sequenced) and microscopy will be repeated in a week.

 

FUS_const_04_07.jpg  NICD_cons_04_07.jpg SPD5_const_04_07.jpg

FUS_const_04_07_2.jpg     

NICD_const_04_07_2.jpg SPD5_const_04_07_2.jpg
FUS_high_04_07.jpg NICD_high 10_07.jpg SPD5_high_04_07.jpg
FUS_high_04_07_2.jpg NICD_high_04_07.jpg SPD5_high_04_07_2.jpg
FUS_mid_04_07.jpg NICD_mid_04_07.jpg SPD5_mid_04_07_2.jpg
FUS_mid_04_07_2.jpg NICD_mid_10_07.jpg SPD5_mod_04_07.jpg
FUS_low_04_07.jpg NICD_Low_04_07.jpg SPD5_low_04_07.jpg
FUS_low_04_07_2.jpg NICD_Low_04_07_1.jpg SPD5_low_04_07_2.jpg

 

8/7/19

Touchdown PCR was started with the EWSR1 constructs, amplified with primer pairs 17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)

17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)

 

9/7/19

Ordered new gBlocks at twist. Ewsr in two parts. 999bp and 1002bp.

Made new TB buffer.

New cloning for EWSR1:

Kinase reaction on the insert with T4 polynucleotide kinase

Find restriction enzymes

  1. pTrc99a empty: digest with sma1 (2h)
  2. Inactivation wth heat (check temperature in NEB): 65°C 20 min
  3. Column purification of the digested backbone: elute in 20uL of water
  4. Measure concentration: take 30-50 ng of template
  5. Take 150 ng of the gblock
  6. Ligation overnight 4°C with ligase
  7. Transform 50uL and plate
  8. Colony PCR to verify (try 10 colonies at first)

Overnight culture in TB medium of constructs FUS3 ind (verified by sequencing), SPD5_1 ind (verified by sequencing) and NICD (not verified) and mini eYFP construct.

New constructs were sent for sequencing

 

10/7/19

Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5

Retransformation of pTrc99a

 

Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5

All cultures were split and induced with different levels of arabinose:

NICD: NICD uninduced, NICD low (0.001%), NICD mid (0.05 %) and high (1%)

FUS: FUS uninduced, FUS low (0.001%), FUS mid (0.05 %) and high (1%)

SPD5: SPD5 uninduced, SPD5 low (0.001%), SPD5 mid (0.05 %) and high (1%)

Control: mini eYFP uninduced and induced with 1 mM IPTG

None of the transformations were successful.

  10-7-FUS_constitutive (1).jpg   10-7-SPD5_constitutive-04.jpg
  10-7-FUS_constitutive (2).jpg    
10-7-eYFP_high (1).jpg 7-10-FUS_high_induction widefield (1).jpg 10-7-NICD_high_10_07_2 (1).jpg  
10-7-eYFP_high (2).jpg 7-10-FUS_high_induction widefield (2).jpg 10-7-NICD_high_10_07_2 (2).jpg  
10-7-eYFP_uninduced (1).jpg 10-7-FUS_mid_induction-03 widefield (1).jpg NICD_mid_10_07_2.jpg  
10-7-eYFP_uninduced (2).jpg 10-7-FUS_mid_induction-03 widefield (2).jpg NICD_mid_10_07.jpg  
  10-7-FUS_low_induction-02 gfp (1).jpg 10-7-NICD_low_10_7_2 (1).jpg  
  10-7-FUS_low_induction-02 gfp (2).jpg 10-7-NICD_low_10_7_2 (2).jpg  
  10-7-FUS_no_induction-03 widefield (1).jpg NICD_unicduced10_7-02.jpg  
  10-7-FUS_no_induction-03 widefield (2).jpg NICD_uninduced 10_7.jpg  

 

11/7/19

Sequencing results show that promoter of the backbones used for the inducible constructs is not AraC but a modified construct. Empty pBad33 plasmid is now

sequenced and restriction site cloning prepared.

Also retransformation of pTrc99a was not successful and will be repeated in order to initialize restriction enzyme cloning of the EWSR1 cloning.

Retransformation ptrc and pbad33 empty as well as backbone for receptor

Pcr of fragments for essays were amplified

FRAP was ameliorated with the constitutive SPD5 construct that has been working since the beginning. 

With a pinhole of 65 um, a laser intensity of 100% and 65 itinerations, droplets were bleached and recovery could be observed over time. 

12/7/19

 

13.7.19

Blade light induction

O/N culture with 3 mL of terrific broth

Measurement of OD in the dark with red light lamp. ODs were all 2.0

Dilution of cutures to OD 0.1

Incubation for 1,5h hours to reach OD 0.4

(ODs were too high, between 0.55 and 0.78) -> dilute

Split cultures (1.5 mL), half of them in dark tubes (uninduced), half of them in light tubes (induced).

Transparent tubes were placed in front of blue LED plate (15,5 V) in 37°C shaker.

4h incubation/illumination

2mL on PBS+Agar plates for microscopy

 

New TB medium: 5g NaCl, 10g Bacto Tryptone and 1 mL of NaOH 1M. Autoclaved.

New overnight culture of FUS (ind), SPD5 (ind), NICD (ind) as well as cells with an empty pBAD (negative control) and a mini eYFP plasmid (positive control)

14. 7.19

 

Measurement of the 5 cultures’ OD at 8 am, dilution to OD 0.1.

1.5h incubation and measurement of OD. All ODs at 0.4

Split cultures:

NICD: NICD uninduced, NICD induced (4h light), NICD induced (1 % arabinose)

FUS: FUS uninduced, FUS induced (4h light), FUS induced (1 % arabinose)

SPD5: SPD5 uninduced, SPD5 induced (4h light), SPD5 induced (1% arabinose)

Empy pBAD: uninduced / 1% Arabinose

Mini eYFP: uninduced / 1% Arabinose

Incubation for 4 hours.

7-14 mini eYFP no arabinose (1).jpg 7-14-FUS_arabinose-02_2 (1).jpg 7-14-NICD_Arabinose_2 (1).jpg 7-14-pBAD negative control (1).jpg 7-14-SPD5_arabinose-02_2 (1).jpg
7-14 mini eYFP no arabinose (2).jpg 7-14-FUS_arabinose-02_2 (2).jpg 7-14-NICD_Arabinose_2 (2).jpg 7-14-pBAD negative control (2).jpg 7-14-SPD5_arabinose-02_2 (2).jpg
YFP_high-06.jpg 7-14-FUS_light_ind_2 (1).jpg 7-14-NICD_light induced_2 (1).jpg   7-14-SPD5_light_ind-02_2 (1).jpg
YFP_high-06_2.jpg 7-14-FUS_light_ind_2 (2).jpg 7-14-NICD_light induced_2 (2).jpg   7-14-SPD5_light_ind-02_2 (2).jpg
  7-14-FUS_uninduced-10 (1).jpg 7-14-NICD_uninducefd-07_2 (1).jpg   7-14SPD5_unind-05_2 (1).jpg
  7-14-FUS_uninduced-10 (2).jpg 7-14-NICD_uninducefd-07_2 (2).jpg   7-14SPD5_unind-05_2 (2).jpg

Text

MCP and ms2 cloning and characterization

Subsection Title

Text

Subsection Title #2

Text

Intein Expression Project

01.07.2019

- PCR of the N-Intein (Npu DnaE, BBa_K1362100)

- Master Mix (50µL):

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19nifwd 10µM 2.5 µL 0.5 µM
Primer: oIG19nirev 10 µM 2.5 µL 0.5 µM
Template DNA 200-300 pg/µL 3 µL 600-900 pg
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 30.5 µL -

- PCR Programm:

Step Temp. Time
Initial Denaturation 98°C 3 min

Denaturation        

Annealing         30x

Extension

98°C

54°C

72°C

10 sec

25 sec

45 sec

Final Extension 72°C 2 min
Hold 4°C -

 


 

02.07.2019

- PCR of the C-Intein (Npu DnaE, BBa_K136201)

Master Mix (50µL):

reagents amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19cifwd 10µM 2.5 µL 0.5 µM
Primer: oIG19cirev 10 µM 2.5 µL 0.5 µM
Template DNA 200-300 pg/µL 3 µL 600-900 pg
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 30.5 µL -

PCR Programm:

Step Temp. Time
Initial Denaturation 98°C 3 min

Denaturation        

Annealing         30x

Extension

98°C

56°C

72°C

10 sec

25 sec

42 sec

Final Extension 72°C 2 min
Hold 4°C -

- Gelelectrophoresis (1% Agarose, 100 V, 50 min, with Midori Green (3 µL/100 mL):

H2O C-Int H2O N-Int ... 1 kb ladder ... C-Int C-Int C-Int N-Int N-Int
PCR Gelelctrophoresis of Inteins

- Gelextraction with NucleoSpin® Gel and PCR Clean-up from Machery-Nagel following the protocol (page 19) at:
https://www.mn-net.com/Portals/8/attachments/Redakteure_Bio/Protocols/DNA%20clean-up/UM_PCRcleanup_Gelex_NSGelPCR.pdf

 


 

04.07.2019

- PCR of pET302 for the C-Intein

Master Mix (50 µL):

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19bbcifwd 10µM 2.5 µL 0.5 µM
Primer: oIG19bbcirev 10 µM 2.5 µL 0.5 µM
Template DNA 86 ng/µL 1 µL 86 ng
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 32.5 µL -

 PCR Programm:

Step Temp. Time
Initial Denaturation 98°C 3 min

Denaturation        

Annealing         30x

Extension

98°C

64°C

72°C

10 sec

30 sec

3 min

Final Extension 72°C 3 min
Hold 4°C -

 


 

05.07.2019

- PCR of pET302 for N-Intein

Master Mix (50 µL):

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19bbnifwd 10µM 2.5 µL 0.5 µM
Primer: oIG19bbnirev 10 µM 2.5 µL 0.5 µM
Template DNA 86 ng/µL 1 µL 86 ng
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 32.5 µL -

 PCR Programm:

Step Temp. Time
Initial Denaturation 98°C 3 min

Denaturation        

Annealing         30x

Extension

98°C

64°C

72°C

10 sec

30 sec

3 min

Final Extension 72°C 3 min
Hold 4°C -

- Gelelektrophoresis (100 V, 90 min, 1% Agarose, Midori Green 3 µL/100 mL) showed no bands

- troubleshooting showed that i used too much DNA

- Did a gradient PCR for C-Int bb:

Master Mix 300 µL:

reagent amount concentration
5X Q5 Reaction Buffer 60 µL 1X
10 mM dNTPs 6 µL 200 µM
Primer: oIG19bbcifwd 10µM 15 µL 0.5 µM
Primer: oIG19bbcirev 10 µM 15 µL 0.5 µM
Template DNA 9.8 ng/µL 1 µL 1,96 ng
Q5 High-Fidelity DNA Polymerase 6 µL 0.02 U/µL
Nuclease-Free Water 200 µL -

- took 50 µL of the mastermix away before adding the DNA to have a H2O control, put the rest in 5 tubes, annealed at the following temperatures:

tube 1 tube 2 tube 3 tube4 tube 5 H2O tube
55,1°C 56,8°C 59,5°C 61°C 63,7°C 63,7°C

PCR Programm:

Step Temp. Time
Initial Denaturation 98°C 3 min

Denaturation        

Annealing         30x

Extension

98°C

-  °C

72°C

10 sec

30 sec

4,5 min

Final Extension 72°C 4.5 min
Hold 4°C -

 


 

06.07.2019

- repeated the gradient-PCR with the pET302 for the N-Intein

 


 

08.07.2019

- Gelelektrophoresis (100V, 1% Agarose, 75 min) showed no bands

- found out that the touch-down function was activated

- did a Gradient PCR for the N-Intein Backbone:

Master Mix 350µL:

reagent amount concentration
5X Q5 Reaction Buffer 70 µL 1X
10 mM dNTPs 7 µL 200 µM
Primer: oIG19bbnifwd 10µM 17.5 µL 0.5 µM
Primer: oIG19bbnirev 10 µM 17.5 µL 0.5 µM
Template DNA 9.8 ng/µL (added after taking 50µL of the MM for H2O control) 0.6 µL 1.96 ng
Q5 High-Fidelity DNA Polymerase 3.5 µL 0.02 U/µL
Nuclease-Free Water 233.9 µL -

- took 50 µL of the mastermix away before adding the DNA to have a H2O control, put the rest in 6 tubes, annealed at the following temperatures:

tube 1 tube 2 tube 3 tube4 tube 5 tube 6 H2O tube
49,2°C 51,5°C 55,2°C 57,3°C 61,1°C 64,1°C 64,1°C

PCR Programm:

Step Temp. Time
Initial Denaturation 96°C 1 min

Denaturation        

Annealing         30x

Extension

96°C

-  °C

72°C

30 sec

30 sec

4.5 min

Final Extension 72°C 10 min
Hold 4°C -

 


 

09.07.2019

- Gelelektrophoresis of the N-Int. BB PCR (100V, 1% Agarose, 75 min, Midori Green (3 µL/100 mL)) showed:

Gelelekt. PCR NI BB

-did a PCR extraction of the tubes of the bands 2,4,5 after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/General_Information/1/high-pure-pcr-product-purification-kit.pdf (page 7)

- repeated the PCR with the same conditions for the C-Intein BB

 


 

10.07.2019

- Gelelektrophoresis of the C-Int. BB PCR (100V, 1% Agarose, 75 min, Midori Green (3 µL/100 mL)) showed:

- did a PCR extraction of the tubes after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/General_Information/1/high-pure-pcr-product-purification-kit.pdf (page 7)

- did 2 Gibson assemblys 1 h, 50°C (protocol: https://international.neb.com/protocols/2014/11/26/nebuilder-hifi-dna-assembly-reaction-protocol) with the following amounts of DNA:

N-Intein (1464bp) BB for N-Intein (5683bp) C-Intein (1259bp) BB for C-Intein (5682bp)
38.64ng 50ng 33.24ng 50ng

- did a transformation with competent TOP10 cells following the protocol of: https://international.neb.com/protocols/0001/01/01/high-efficiency-transformation-protocol-c2987

- platet the cells on Agar plates with Ampicillin and let grow overnight at 37°C

 


 

11.07.2019

- no colonies on the plates

- did a gelelectrophoresis (1% Agarose, 100 V, 75 min, Midori Green (3 µL/100 mL)) with the following DNA Products:

ladder N-Int BB for N-Int Gibson BB+N-Int (40ng) C-Int BB for C-Int Gibson BB+C-Int (40ng) ladder

 - had to do a post-staining with Gel-Red (30 min):

- bands of coiled plasmids can be seen in the top area

- did another transformation with NEB 5-alpha competent cells following this protocol: https://international.neb.com/protocols/0001/01/01/high-efficiency-transformation-protocol-c2987

- plated on Agar plates with Ampicillin and let grow overnight at 37°C

 


 

12.07.2019

- colonies did grow overnight and did show red fluorescence as the should with a functioning biobrick inserted into the plasmid

- picked colonies and let grow overnight at 37°C in 2ml of LB-medium with Ampicillin (100 µg/ml) each

 


 

13.07.2019

- cultures did grow well,  a miniprep was performed following this protocol: https://files.zymoresearch.com/protocols/_d4208t_d4209_d4210_d4211_d4212_zymopure_plasmid_miniprep.pdf (page 4 + 6)

- with the harvested plasmids a PCR was performed to insert a point mutation to delete a BsaI restriction site:

PCR Programm: BsaI point mutation :

Master Mix 1 (50µL) each for N-/C-Intein:

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19bbBsaI mut fwd 10µM 2.5 µL 0.5 µM
Primer: oIG19bbBsaI mut rev 10 µM 2.5 µL 0.5 µM
Template DNA 1.2 ng/µL 1 µL 1.2 ng
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 30.5 µL -
DMSO 2 µL 4%

Master Mix 2 (50µL) each for N-/C-Intein:

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19bbBsaI mut fwd 10µM 2.5 µL 0.5 µM
Primer: oIG19bbBsaI mut rev 10 µM 2.5 µL 0.5 µM
Template DNA 1.2 ng/µL 1 µL 1.2 ng
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 32.5 µL -

PCR Programm:

Step Temp. Time
Initial Denaturation 96°C 1.5 min

Denaturation        

Annealing         30x

Extension

96°C

72°C

72°C

35 sec

30 sec

5 min 45 sec

Final Extension 72°C 10 min
Hold 4°C -

 


 

15.07.2019

- did a gelelectrophoresis (1% Agarose, 100 V, 80 min, Midori Green (3 µL/100 mL)), no plasmid bands

- did a gradient PCR with the N-Intein + BB to get out the BsaI restriction site:

Master Mix (150µL for 10 tubes):

reagent amount concentration
5X Q5 Reaction Buffer 30 µL 1X
10 mM dNTPs 3 µL 200 µM
Primer: oIG19bbBsaI mut fwd 10µM 7.5 µL 0.5 µM
Primer: oIG19bbBsaI mut rev 10 µM 7.5 µL 0.5 µM
Template DNA 1.2 ng/µL 3 µL 1.2 ng/50 µL
Q5 High-Fidelity DNA Polymerase 1.5 µL 0.02 U/µL
Nuclease-Free Water 97.5 µL -

Annealing Temperatures: 

tube 1 2 3 4 5 6 7 8 9 H2O
temp. 55°C 56.2°C 57.5°C 59.4°C 62°C 65°C 67.6°C 69.5°C 71.6°C 71.6°C

PCR Programm:

Step Temp. Time
Initial Denaturation 96°C 1.5 min

Denaturation        

Annealing         30x

Extension

96°C

- °C

72°C

35 sec

30 sec

5 min 45 sec

Final Extension 72°C 10 min
Hold 4°C -

- Gelelectrophoresis showed no bands

 


 

16.07.2019

- Did a PCR with the N-Int. with 3, 5 and 10% DMSO whith the annealing temperatures = Tm - 0.6°C x 1% DMSO

- Gelelectrophoresis showed a band of the right size (on the right, same size as +ctrl on the left)

 


 

16.07.2019

- Did a DpnI Digestion of the N-Int 10% DMSO tube (0.5 µL DpnI, 1 h, 37°C)

- Did a PCR-Extraction after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/Bulletin/1/hppcrpkrobul.pdf (page 7)

- Did 2 PCRs of the C-Intein, one with BsaI mut fwd and a rev Primer in the Amp. Resistance, and one with BsaI mut rev and a fwd primer in the Amp. Res.

 


 

17.07.2019

- Gelelctrophoresis showed bands of the right size for the two PCRs with the Primers inside of the Amp. Resistance, both constructs were isolated with Gel-Extraction and a Gibson Asembly was performed

- Did a Transformation with the N-Int construct (out of the 10% DMSO tube) and the C-Int construct (out of the Gibbson assembly) into NEB Alpha-5 competent cells

- plated on Agar plates with Amp and let incubate overnight at 37°C

 


 

18.07.2019

- colonies did grow for both constructs! picked 3 colonies each and put into 2 mL of LB medium with Amp, let grow overnight

 


 

19.07.2019

- did a mini-prep of each culture with Zymo-Miniprep kit, send the isolated plasmids to sequencing

 


 

24.07.2019

- Sequencing uncomplete because of wrong primers but point mutations were inserted succesful in both constructs

- repeated sequencing with other primers

 


 

25.07.2019

- Sequencing showed that the N-Int has no unwanted pointmutations and the insert is fully inserte

- but the C-Intein construct is not fully inserted, parts of the insert are missing, will repeat the point mutation PCR with 10% DMSO instead of the Gibson approach

 


 

26.07.2019

- Gelelectrophoresis showed no bands

- did a PCR (following https://international.neb.com/protocols/2013/12/13/pcr-using-q5-high-fidelity-dna-polymerase-m0491) with the C-Intein + BB with the fwd and rev Primer in seperate tubes (16 cycles), then  mixed together and did 14 cycles

 


 

27.07.2019

- Gelelectrophoresis showed a band that was approx. 500bp to small

- looking closer at the sequence showed ~75% GC content at one region

 


 

28.07.2019

- repeated the PCR of C-Int + BB with seperated Primer but added GC-Enhancer

Master Mix (50µL each)

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19BB bsaI mut fwd / rev 2.5 µL 0.5 µM
Template DNA (C-Int + BB) 1 ng/µL 1 µL 1 ng
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 25 µL -
High GC-Enhancer 10 µL 1X

PCR Programm:

Step Temp. Time
Initial Denaturation 96°C 1 min

Denaturation        

Annealing         16x, then mix both tubes, 14x

Extension

96°C

70°C

72°C

30 sec

30 sec

5 min

Final Extension 72°C 10 min
Hold 4°C -

 


 

29.07.2019

- Gelelctrophoresis showed band of the right size (ladder, +ctrl, tube 1. tube 2, too short band without GC-Enhancer):

- did a PCR-Purification of the remaining samples

- did transformation of the mutated C-Int + BB construct with competent NEB 5-alpha cells, platet on Agarplates with Amp, incubated overnight

- picked colonies with the SUMO1-Plasmid (obtained from BIOSS Toolbox, University Freiburg) and cultured them in 3 mL LB-Medium with Amp. overnight

 


 

30.07.2019

- Did a Mini Prep of the SUMO1 cultures

- Did a PCR with TrxA (obtained from Di Ventura Lab, University Freiburg)(Primers: IG19BB TrxA fwd/rev) and with SUMO1 (Primers: IG19BB SUMO1 fwd/rev) , introduced the overhangs from RFC105 for the Golden Gate Assembly

- Gelelctrophoresis (100bp ladder, SUMO1, TrxA, 1kb ladder):

- both PCR products had the right size: PCR purification

- Picked colonies with the mutated C-Int + BB construct (from 29.07) and cultured them in 2 mL LB-Medium with Amp overnight

 


 

31.07.2019

- Did a Mini Prep of the cultures with the mutated C-Int + BB construct

- Send them to Sequencing

 


 

01.08.2019

- Sequencing succesful

- Inserted SUMO1 into N-Int + BB mut and TrxA into the C-Int. + BB mut constructs, both with Golden Gate Assembly:

Master Mix (each): 3:1 (Insert:Backbone(150ng)), 1.5 µL T4 DNA Ligase Buffer, 9 µL dH20 (filled up to 15 µL), 1µL BsaI, 1µL T4 DNA Ligase

Cycler Program:

Step Temp. Time

Restriction

                       x25

Ligation

37°C

 

16°C

3 min

 

4 min

Final Restriction 50°C 5 min
Denaturation 80°C 5 min
Hold 4°C -

- Did a Transformation with NEB 5-Alpha comp. cells with 2 or 4 µL of the Golden Gate product and plated the cells on Agar plates with Amp., incubated at 37°C o/n

 


 

02.08.2019

- colonies did grow! picked 2 of each construct and cultured in 2 mL LB-Medium with Amp.

- after 7 hours did a Mini Prep and sent all DNA to Sequencing

- reincubated the remaining cells in the tube in 4mL LB-Medium with Amp.

 


 

04.08.2019

- Did a Miniprep of the NI-SUMO1 and CI-Trx cultures, same cultures as sent to sequencing, did this to have enough DNA

 


 

05.08.2019

- Sequencing showed that Golden Gate Asembly was performed succesful

 


 

11.08.2019

- Cultured bacteria with NI-SUMO and CI-TRX in 2 mL LB-medium + Amp at 37°C for 6 hours

- measured OD and put the amount of bacteria into 4 mL of LB -medium + Amp to have OD 0.1, incubated 1 hour at 37°C

- after 1 h added IPTG with 1mM end concentration, incubated 2 more hours then pelletized and stored pellets o/n at -80°C

 


 

12.08.2019

- resuspended the pellets in 250 µL Promega FastBreak Lysis Buffer, added PMSF (1mM), sonicated the cells (3 x 6 cycles of 1 min, max volume)

- centrifuged the lysate 15 min at max speed at 4°C, took the supernatant and stored on ice

- prepared 4 tubes:

tube 1 2 3 4
ingredients

50 µL NI-SUMO1

5mM DTT

50 µL CI-TRX

5mM DTT

100 µL NI-SUMO1

100 µL CI-TRX

100 µL NI-SUMO1

100 µL CI-TRX

5mM DTT

- took 20 µL samples of each tube directly and then each hour (T0-T4), added 5 µL 5xSDS-Buffer and cooked 10 min at 95°C

 

- performed the following PCRs:

PCR-Programm: C-Int BB for Sec-Tag Insertion:

Master Mix (50µL)

reagent amount concentration
5X Q5 Reaction Buffer 10 µL 1X
10 mM dNTPs 1 µL 200 µM
Primer: oIG19BB C-Int BB T7 Term fwd 2.5 µL 0.5 µM
Primer: oIG19BB C-Int for sfGFP rev 2.5 µL 0.5 µM
Template DNA (C-Int + BB mut) 0.4ng/µL 2.5 µL 1 ng
Q5 High-Fidelity DNA Polymerase 0.5 µL 0.02 U/µL
Nuclease-Free Water 21 µL -
High GC-Enhancer 10 µL 1X

PCR Programm:

Step Temp. Time
Initial Denaturation 96°C