|
|
| Line 8: |
Line 8: |
| | </div> | | </div> |
| | <div class="labbook"> | | <div class="labbook"> |
| − | <p style="color: black; margin: 0 10%; font-size: 1.6em; padding-bottom: 50px;"> Short description of what has been done </p> | + | <!-- <p style="color: black; margin: 0 10%; font-size: 1.6em; padding-bottom: 50px;"> Short description of what has been done </p > --> |
| | <p style="color: black; margin: 0 20%; font-size: 1.3em"> Click on an item for a detailed description </p> | | <p style="color: black; margin: 0 20%; font-size: 1.3em"> Click on an item for a detailed description </p> |
| | <div class="labbookentry"> | | <div class="labbookentry"> |
| Line 489: |
Line 489: |
| | <p>After transformation of NICD was ineffective, proportions were calculated again and ligation was repeated. Incubation overnight follows.</p> | | <p>After transformation of NICD was ineffective, proportions were calculated again and ligation was repeated. Incubation overnight follows.</p> |
| | | | |
| − | <p>Furthermore, gBlocks for EWSR1, FUS, SPD5_1 and SPD5_2 were amplified to create overlaps with following Primers:</p> | + | <p>Furthermore, gBlocks for EWSR1, FUS, SPD5_1 and SPD5_2 were amplified to create overlaps with following |
| − | | + | |
| − | <p>EWSR1 with Primers 17 and 18*</p>
| + | |
| − | | + | |
| − | <p>FUS with Primers 3 and 4*</p>
| + | |
| − | | + | |
| − | <p>SPD5_1 and SPD5_2 with Primers 9&10 and 11&12 respectively*</p>
| + | |
| − | | + | |
| − | <p>*For primer and protein sequences see <a href="...%2004.06.19">protocol from 04.06.2019.</a></p>
| + | |
| − | | + | |
| − | <p>Amplification was only successful for SPD5_2 in the first round:</p>
| + | |
| − | | + | |
| − | <p><<img alt="" height="329" src="https://2019.igem.org/wiki/images/2/23/T--Freiburg---In-Vivo-11.06.019_2.JPG" width="438" /></p>
| + | |
| − | | + | |
| − | <p>PCR troubleshooting consisted of repeating the reaction with two different polymerases, being Q5 and Phusion Flash, as well as adding 3% DMSO to the DNA mix. In the case of EWSR1, DNA was increased to 2 ng.</p>
| + | |
| − | | + | |
| − | <p>In the second round, bands for each sequence could be seen, were cut and purified. </p>
| + | |
| − | | + | |
| − | <p><img alt="" height="327" src="https://2019.igem.org/wiki/images/5/5a/T--Freiburg---In-Vivo-11.06.2019.JPG" width="438" /></p>
| + | |
| − | </p>
| + | |
| − | <h2> 12.06.19 </h2>
| + | |
| − | <p> Transformation from the day before was unsuccessful, no colonies were on the plate. We found out we used Ampicillin plates, which is the wrong antibiotic. </p>
| + | |
| − | | + | |
| − | <p>Since all required sequences for the designed plasmids (for more information about plasmid constructs see protocol from day 04.06.2019) were now amplified, ligation for all plasmids could now start. The method used was Gibson Cloning. The gibson assemblies were then plated on Chloramphenicol plates and incubated overnight.</p>
| + | |
| − | <h2> 13.06.19 </h2>
| + | |
| − | | + | |
| − | <p>Gibson assembly of the Plasmids containing NICD and SPD5, EWSR.</p>
| + | |
| − | | + | |
| − | <p>Following constructs were ligated with NEB HiFi Ligase:</p>
| + | |
| − | | + | |
| − | <p>Fus: A + B + C (Fus)</p>
| + | |
| − | | + | |
| − | <p>EWSR1: H, I, J (EWSR1)</p>
| + | |
| − | | + | |
| − | <p>SPD5: D, E, F(SPD5_1) and G (SPD5_2)</p>
| + | |
| − | | + | |
| − | <p>Together with the ligated NICD plasmid, all plasmids were transformed into competent E. Coli and plated on chloramphenicol plates.</p>
| + | |
| − | | + | |
| − | <p>Plates were incubated overnight at 37°C</p>
| + | |
| − | <h2> 14.06.19 </h2>
| + | |
| − | | + | |
| − | <p>Plates containing FUS, SPD5 and NICD from 13.06.2019 had colonies. EWSR1 had no colonies.</p>
| + | |
| − | | + | |
| − | <p>Coloies were picked and LB medium with Chloramphenicol was inoculated, bacteria was grown in media for 5 hours and prepared for sequencing. </p>
| + | |
| − | | + | |
| − | <p>A second set of media were incoulated and prepared for microscopy. Samples were visualized with a Widefield microscope and analyzed with FiJi. Images attached.</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <p>SPD5 sample 2: Dispersed fluroescence (left). No indication for droplets found.</p>
| + | |
| − | | + | |
| − | <p><img alt="" height="345" src="https://2019.igem.org/wiki/images/9/9c/T--Freiburg---In-Vivo-SPD5_1-04.jpg" width="430" /><img alt="" height="344" src="../../imgs/In-Vivo/SPD5_1-04_02.jpg" width="430" /></p>
| + | |
| − | | + | |
| − | <p>SPD5 sample 1. Lighter spots that can be an indication for droplets in the fluorescent image (Left) that are not visible on the right.</p>
| + | |
| − | | + | |
| − | <p><img alt="" height="343" src="https://2019.igem.org/wiki/images/9/97/T--Freiburg---In-Vivo-SPD5_1-02.jpg" width="427" /><img alt="" height="342" src="../../imgs/In-Vivo/SPD5_1-02_02.jpg" width="426" /></p>
| + | |
| − | | + | |
| − | <p>FUS sample 1. Low, dispersed fluorescence (left). No indications for droplets.</p>
| + | |
| − | | + | |
| − | <p><img alt="" height="343" src="https://2019.igem.org/wiki/images/e/e6/T--Freiburg---In-Vivo-FUS_2-03.jpg" width="427" /><img alt="" height="343" src="../../imgs/In-Vivo/FUS_2-03_02.jpg" width="428" /></p>
| + | |
| − | | + | |
| − | <p>NICD sample 1. Low, dispersed fluorescence (left). No indications for droplets.</p>
| + | |
| − | | + | |
| − | <p><img alt="" height="342" src="https://2019.igem.org/wiki/images/1/1d/T--Freiburg---In-Vivo-NICD_2-06.jpg" width="426" /><img alt="" height="341" src="../../imgs/In-Vivo/NICD_2-06_02.jpg" width="425" /></p>
| + | |
| − | | + | |
| − | <p>Problem with NICD: A cloning mistake has led to an excessive atg start codon at the begining of sfGFP, which may give misleading results.</p>
| + | |
| − | | + | |
| − | <p>Complementary primers for a site directed mutagenesis deleting the excessive three bases were ordered. </p>
| + | |
| − | | + | |
| − | <p><img alt="" height="318" src="https://2019.igem.org/wiki/images/3/3f/T--Freiburg---In-Vivo-atg.JPG" width="321" /></p>
| + | |
| − | | + | |
| − | <p>Criteria for identifying if an accumulation of fluorescent proteins are dynamic droplets or dead aggregates:</p>
| + | |
| − | | + | |
| − | <p>1. They appear in a concentration dependent manner,</p>
| + | |
| − | | + | |
| − | <p>2. They fuse when they encounter another one of their kind,</p>
| + | |
| − | | + | |
| − | <p>3. Fluorescence regeneraties after photobleaching (FRAP)</p>
| + | |
| − | | + | |
| − | <p>In order to determine whether the results seen in the last protocol are significant, the constructed proteins have to be inducible to be seen under different concentrations.</p>
| + | |
| − | | + | |
| − | <p>Cloning steps were repeated so that the constructs could be positioned in front of inducible promoters. Additionally, EWSR1 will be inserted in a different backbone with</p>
| + | |
| − | | + | |
| − | <p>compatible origins of replications with the pBAD backbone, so that FUS and EWSR1 can be induced in the same bacteria without competition. The new backbone for </p>
| + | |
| − | | + | |
| − | <p>EWSR1 is pTrc99a (empty) with a prc promoter.</p>
| + | |
| − | | + | |
| − | <p>Following primers are now added to the list:</p>
| + | |
| − | | + | |
| − | <table style="border-collapse:collapse; width:1041pt; border:none" width="1389">
| + | |
| − | <colgroup>
| + | |
| − | <col style="width:60pt" width="80" />
| + | |
| − | <col style="width:136pt" width="182" />
| + | |
| − | <col style="width:204pt" width="272" />
| + | |
| − | <col style="width:311pt" width="415" />
| + | |
| − | <col style="width:330pt" width="440" />
| + | |
| − | </colgroup>
| + | |
| − | <tbody>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td height="19" style="border:none; height:14.25pt; width:60pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="80"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">New primers</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; width:136pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="182"> </td>
| + | |
| − | <td style="border:none; width:204pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="272"> </td>
| + | |
| − | <td style="border:none; width:311pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="415"> </td>
| + | |
| − | <td style="border:none; width:330pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="440"> </td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Number</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Name</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Tube name</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Sequence</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Description</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">31</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">TGGATGAGCTCTACAAATAA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">AAGCTTGGCTGTTTTGGCGG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">32</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">AGGACAGAGTTATCTTCCAT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TCTAGAGGATCCCCGGGTAC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">32_2</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl70" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_1_mid_GFP_rev</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl70" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_1_mid_GFP_rev</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl72" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GTGCAATAGT<font><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">GAAACGACGCGACGC</span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif"> </span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">33</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl73" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GTACCCGGGGATCCTCTAGA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">ATGGAAGATAACTCTGTCCTTAA</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify SPD5_1 with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">34</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CCGCCAAAACAGCCAAGCTT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TTATTTGTAGAGCTCATCCATGC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify GFP with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">35</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CATGGAATTCGAGCTCGGTA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">ATGGCCTCAACTGACTACTC</span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify EWSR1 with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">36</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GACTCTAGAGGATCCCCGGG<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TTAGTACAGCTCGTCCATGC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify mCherry with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">37</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl74" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:700"><span style="font-family:Arial,sans-serif"><span style="font-style:normal"><span style="text-decoration:none"> <font><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">pTrc99A FWD</span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl74" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:700"><span style="font-family:Arial,sans-serif"><span style="font-style:normal"><span style="text-decoration:none"> <font><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">pTrc99A FWD</span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GCATGGACGAGCTGTACTAA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">CCCGGGGATCCTCTAGAGTC</span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify pTrc99A (induceable promoter) with right overlaps</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">38</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pTrc99A REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pTrc99A REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GAGTAGTCAGTTGAGGCCAT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TACCGAGCTCGAATTCCATG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify pTrc99A (induceable promoter) with right overlaps</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">39</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33_FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33_FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl73" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GTACCCGGGGATCCTCTAGA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">ATGAATGCGTCATGTGTAGG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify NICD with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">39_2</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl75" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_mid_sfGFP_REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl70" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_mid_sfGFP_REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl72" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">TCCTTTGCTCAT<font><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">GGATCCTCCGGATCCTC</span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify NICD with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">40</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33 REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33 REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CCGCCAAAACAGCCAAGCTT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TTATTTGTAGAGCTCATCCATGC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify sfGFP with the right overlap for new backbone</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">41</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD FWD</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">TGGATGAGCTCTACAAATAA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">AAGCTTGGCTGTTTTGGCGG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">42</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD REV</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CCTACACATGACGCATTCAT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TCTAGAGGATCCCCGGGTAC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | </tr>
| + | |
| − | <tr height="21" style="height:15.75pt">
| + | |
| − | <td height="21" style="border:none; height:15.75pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td class="xl63" colspan="2" style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:12pt"><span style="color:#333333"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primers for NICD atg deletion</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">atg_del_fwd</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl64" style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">GATCCGGAGGATCCAGCAAAGGAGAAGAAC</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | </tr>
| + | |
| − | <tr height="21" style="height:15.75pt">
| + | |
| − | <td height="21" style="border:none; height:15.75pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">atg_del_Rev</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl65" style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:12pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">GTTCTTCTCCTTTGCTGGATCCTCCGGATC </span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <p>Constructs cotnaining the backbone with inducible promoters will be the following:</p>
| + | |
| − | | + | |
| − | <p>FUS, containing the following fragments</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td>XA</td>
| + | |
| − | <td>pBAD</td>
| + | |
| − | <td>w/primers 29&30</td>
| + | |
| − | <td>68°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XB</td>
| + | |
| − | <td>GFP</td>
| + | |
| − | <td>w/ primers 5&28</td>
| + | |
| − | <td>63°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XC</td>
| + | |
| − | <td>FUS</td>
| + | |
| − | <td>w/ primers 27&4</td>
| + | |
| − | <td>68°C</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <p>SPD5, containing the following fragments</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td>XD</td>
| + | |
| − | <td>pBAD</td>
| + | |
| − | <td>w/primers 31&32</td>
| + | |
| − | <td>68°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XE</td>
| + | |
| − | <td>GFP</td>
| + | |
| − | <td>w/primers 13&34</td>
| + | |
| − | <td>63°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XF</td>
| + | |
| − | <td>SPD1</td>
| + | |
| − | <td>w/primers 33&10</td>
| + | |
| − | <td>60°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>G</td>
| + | |
| − | <td>SPD2</td>
| + | |
| − | <td> </td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>EWSR1, containing the following fragments:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td>XG</td>
| + | |
| − | <td>pBAD</td>
| + | |
| − | <td>w/primers 37&38</td>
| + | |
| − | <td>65°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XH</td>
| + | |
| − | <td>EWSR1</td>
| + | |
| − | <td>w/primers 35&18</td>
| + | |
| − | <td>65°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XI</td>
| + | |
| − | <td>mCherry</td>
| + | |
| − | <td>w/primers 19&36</td>
| + | |
| − | <td>65°C</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>NICD, containing the following fragments:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td>XJ</td>
| + | |
| − | <td>pBAD</td>
| + | |
| − | <td>w/primers 41&42</td>
| + | |
| − | <td>68°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XK</td>
| + | |
| − | <td>sfGFP</td>
| + | |
| − | <td>w/primers 25&40</td>
| + | |
| − | <td>63°C</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>XL</td>
| + | |
| − | <td>NICD</td>
| + | |
| − | <td>w/primers 39&24</td>
| + | |
| − | <td>63°C</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <p>Amplifications for the gibson fragments with corrresponding sticky ends were started in order to achieve plasmids with the constructs in front of inducible promoters.</p>
| + | |
| − | | + | |
| − | <p><img alt="" height="338" src="https://2019.igem.org/wiki/images/9/9b/T--Freiburg---In-Vivo-PCR.JPG" width="516" /><img alt="" height="334" src="../../imgs/In-Vivo/PCRteil2.JPG" width="561" /></p>
| + | |
| − | | + | |
| − | <p>Image left and right: 1% agarose gel with results of amplification of gibson fragments. </p>
| + | |
| − | | + | |
| − | <p>All Fragments except EWSR1 gBlock could be successfully amplified. New primers were ordered as part of the troubleshooting procedure. </p>
| + | |
| − | | + | |
| − | <p>The new primers are:</p>
| + | |
| − | | + | |
| − | <table style="border-collapse:collapse; width:777pt; border:none" width="1036">
| + | |
| − | <colgroup>
| + | |
| − | <col style="width:60pt" width="80" />
| + | |
| − | <col style="width:158pt" width="211" />
| + | |
| − | <col style="width:216pt" width="288" />
| + | |
| − | <col style="width:343pt" width="457" />
| + | |
| − | </colgroup>
| + | |
| − | <tbody>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl63" height="19" style="border:none; border-bottom:none; height:14.25pt; width:60pt; border-top:1pt solid windowtext; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="80"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">43</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl64" style="border:none; border-bottom:none; width:158pt; border-top:1pt solid windowtext; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="211"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pTrc99a_rev</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl65" style="border:none; border-bottom:none; width:216pt; border-top:1pt solid windowtext; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="288"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">pTrc99a_inducible_rev, </span></span></span></span></span></span></td>
| + | |
| − | <td class="xl66" style="border:none; border-bottom:none; width:343pt; border-top:1pt solid windowtext; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="457"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">ttgaggccatTACCGAGCTCGAATTCCATG</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">44</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_fwd</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_inducible_fwd,</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">gagctcggtaATGGCCTCAACTGACTACTC</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">45</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_rev</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_inducible_rev</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">46</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_fwd</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_inducible_fwd</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="19" style="height:14.25pt">
| + | |
| − | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">47</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_rev</span></span></span></span></span></span></td>
| + | |
| − | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_inducible_rev,</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">gatccccgggGTACAGCTCGTCCATGCC</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | <tr height="20" style="height:14.65pt">
| + | |
| − | <td align="right" class="xl69" height="20" style="border:none; border-bottom:1pt solid windowtext; height:14.65pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">48</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl70" style="border:none; border-bottom:1pt solid windowtext; border-top:none; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">pTrc99a_fwd</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl70" style="border:none; border-bottom:1pt solid windowtext; border-top:none; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">pTrc99a_inducible_fwd</span></span></span></span></span></span></td>
| + | |
| − | <td class="xl71" style="border:none; border-bottom:1pt solid windowtext; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">cgagctgtacCCCGGGGATCCTCTAGAG</span></span></span></span></span></span></td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h3 style="margin: 0cm 0cm 8pt;"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Labbook </span></span></span></strong></h3>
| + | |
| − | | + | |
| − | <h3 style="margin: 0cm 0cm 8pt;"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">25/6/19</span></span></span></strong></h3>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR for SPD5_1 and FUS and NICD with new primers and extract from agarose gel. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Transform into competent cells and grow overnight culture.</span></span></span></p>
| + | |
| − | | + | |
| − | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">26/6/19</span></span></span></h2>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Planning of FRAP experiment</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Widefield and Brightfield microscopy of samples </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Gibson assembly of FUSinducible (XA, XB, XC) </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">50 ng of Backbone (1uL) </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">50 ng sfGFP (2,78 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">73 ng FUS (0.73 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Retransformation of bacteria with correctly sequenced constructs (constitutive)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR for NICD and SPD5 fragments</span></span></span></p>
| + | |
| − | | + | |
| − | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">27/6/19</span></span></span></h2>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Miniprep of assembled FUS </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR of fragments XC, XF, XL, XH and HI (not successful except XC, XF)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR of fragments XH XI and XL with 3% DMSO</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Gibson assembly of NICD and SPD5 with correct amplified fragments.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">NICD: 50 ng Backbone (0,63 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">23,86 ng sfGFP (2,06 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">51,14 ng NICD (2,60 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5: 50 ng Backbone (2.5 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">sfGFP: 24,68 ng (1,1 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5_1: 68,18 (4,54 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5_2: 51,14 (1,17 uL)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">2/7/19</span></span></span></h2>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">PCR of EWSR1 with primers 17&18, 18&35 and 44&45 in order to amplify EWSR1 constitutive and EWSR1 inducible (twice) </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">PCR was not successful. Next step is a Touchdown PCR starting at 75°C and going down to 65°C (annealing temperature of the three constructs)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Induceable constructs were retransformed (NICD was made again by Gibson assembly)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Constitutive constructs were retransformed. All retranformations were plated on Chloramphenicol plates and placed overnight in the 37°C incubator. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">3/7/19</span></span></span></h2>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Colonies were picked and new overnight cultures were prepared from the retransformation of the constructs (induceable and constitutive) for the FRAP experiment.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New Glycerol stocks from all constructs were frozen at -80°C</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Glucose free TB medium was mixed, heated and autoclaved in order to prepare the induction and FRAP experiment.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New Chloramphenicol plates were made (LB medium + 400uL 34g/mol Chloramphenicol stock solution added at 50°C)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">4/7/19</span></span></span></h2>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Microscopy of the working constructs (constitutive FUS, NICD and SPD5 as well as Arbinose-inducible FUS, NICD and SPD5) and the negative control IPTG-inducible</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">mini eYFP which is known to form aggregates at high concentrations (source: AG Di Ventura, BIOSS Freiburg).</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Induction was carried out with the following concentrations:</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">No induction: E. coli carrying plasmids were grown overnight in TB, diluted to OD 0.01 in the morning, grown to OD 0.5 and further incubated for 2h at 37°C with vigorous shaking.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Induction: E. coli were grown in overnight culture in TB medium, diluted to OD 0.01 in the morning, grown to OD 0.5 and induced with the following concentrations of Arabinose:</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">LOW: 0.001% Arabinose</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">MID: 0.05% Arabinose</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">HIGH: 1% Arabinose</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">After 2h in the incubater at 37°C and vigorous shaking, miscroscopy was carried out.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">At first, samples were analysed with brightfield and widefield GFP microscopy. Cells were checked for droplet like dots. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Most cells didn’t show droplet-like structures, only constitutive SPD5 (as already shown before). Induction seemed to not have worked, since the positive control </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">plasmid mini eYFP did not show the expected results. Furthermore, general fluorescence of mid and high induced cells was not to be distinguished from low induced cells in most cases. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">The constitutive SPD5 probe containing droplet-like structures was analysed under the confocal microscope at 100x. Bleaching was done with 100% laser </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">intensity with an itinerary of 20. Single droplet like structures were bleached and the Region of Interest (ROI) was analysed, while other ROIs were only analised. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Results did not seem to be clear. Induceable constructs are analysed (sequenced) and microscopy will be repeated in a week. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385136/FUS_const_04_07.jpg" onclick="window.location.href = '1385136?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_const_04_07.jpg</a> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385191/NICD_cons_04_07.jpg" onclick="window.location.href = '1385191?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_cons_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385231/SPD5_const_04_07.jpg" onclick="window.location.href = '1385231?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_const_04_07.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p style="margin:0cm 0cm 8pt"><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385141/FUS_const_04_07_2.jpg" onclick="window.location.href = '1385141?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_const_04_07_2.jpg</a> </p>
| + | |
| − | </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385196/NICD_const_04_07_2.jpg" onclick="window.location.href = '1385196?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_const_04_07_2.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385236/SPD5_const_04_07_2.jpg" onclick="window.location.href = '1385236?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_const_04_07_2.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385146/FUS_high_04_07.jpg" onclick="window.location.href = '1385146?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_high_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385201/NICD_high%2010_07.jpg" onclick="window.location.href = '1385201?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_high 10_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385241/SPD5_high_04_07.jpg" onclick="window.location.href = '1385241?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_high_04_07.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385151/FUS_high_04_07_2.jpg" onclick="window.location.href = '1385151?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_high_04_07_2.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385206/NICD_high_04_07.jpg" onclick="window.location.href = '1385206?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_high_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385246/SPD5_high_04_07_2.jpg" onclick="window.location.href = '1385246?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_high_04_07_2.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385166/FUS_mid_04_07.jpg" onclick="window.location.href = '1385166?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_mid_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385226/NICD_mid_04_07.jpg" onclick="window.location.href = '1385226?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_mid_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385261/SPD5_mid_04_07_2.jpg" onclick="window.location.href = '1385261?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_mid_04_07_2.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385171/FUS_mid_04_07_2.jpg" onclick="window.location.href = '1385171?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_mid_04_07_2.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385106/NICD_mid_10_07.jpg" onclick="window.location.href = '1385106?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_mid_10_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385266/SPD5_mod_04_07.jpg" onclick="window.location.href = '1385266?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_mod_04_07.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385156/FUS_low_04_07.jpg" onclick="window.location.href = '1385156?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_low_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385216/NICD_Low_04_07.jpg" onclick="window.location.href = '1385216?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_Low_04_07.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385251/SPD5_low_04_07.jpg" onclick="window.location.href = '1385251?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_low_04_07.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385161/FUS_low_04_07_2.jpg" onclick="window.location.href = '1385161?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_low_04_07_2.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385221/NICD_Low_04_07_1.jpg" onclick="window.location.href = '1385221?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_Low_04_07_1.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385256/SPD5_low_04_07_2.jpg" onclick="window.location.href = '1385256?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_low_04_07_2.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><u><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">8/7/19</span></span></span></strong></u></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Touchdown PCR was started with the EWSR1 constructs, amplified with primer pairs 17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">9/7/19 </span></span></span></strong></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Ordered new gBlocks at twist. Ewsr in two parts. 999bp and 1002bp.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Made new TB buffer.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New cloning for EWSR1:</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Kinase reaction on the insert with T4 polynucleotide kinase </b></span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Find restriction enzymes</b></span></span></span></p>
| + | |
| − | | + | |
| − | <ol>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>pTrc99a empty: digest with sma1 (2h)</b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Inactivation wth heat (check temperature in NEB): 65°C 20 min</b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Column purification of the digested backbone: elute in 20uL of water</b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Measure concentration: take 30-50 ng of template</b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Take 150 ng of the gblock</b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Ligation overnight 4°C with ligase </b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Transform 50uL and plate</b></span></span></span></li>
| + | |
| − | <li style="margin:0cm 0cm 8pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Colony PCR to verify (try 10 colonies at first)</b></span></span></span></li>
| + | |
| − | </ol>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Overnight culture in TB medium of constructs FUS3 ind (verified by sequencing), SPD5_1 ind (verified by sequencing) and NICD (not verified) and mini eYFP construct.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New constructs were sent for sequencing</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">10/7/19</span></span></span></strong></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Retransformation of pTrc99a </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">All cultures were split and induced with different levels of arabinose:</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">NICD: NICD uninduced, NICD low (0.001%), NICD mid (0.05 %) and high (1%)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">FUS: FUS uninduced, FUS low (0.001%), FUS mid (0.05 %) and high (1%)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5: SPD5 uninduced, SPD5 low (0.001%), SPD5 mid (0.05 %) and high (1%)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Control: mini eYFP uninduced and induced with 1 mM IPTG</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span lang="EN-GB" style="font-size:11.0pt"><span style="line-height:107%"><span style="font-family:"Calibri",sans-serif">None of the transformations were successful.</span></span></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385026/10-7-FUS_constitutive%20(1).jpg" onclick="window.location.href = '1385026?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_constitutive (1).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385101/10-7-SPD5_constitutive-04.jpg" onclick="window.location.href = '1385101?op=preview&back_url=1366648'; return false">10-7-SPD5_constitutive-04.jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385031/10-7-FUS_constitutive%20(2).jpg" onclick="window.location.href = '1385031?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_constitutive (2).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385006/10-7-eYFP_high%20(1).jpg" onclick="window.location.href = '1385006?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_high (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384996/7-10-FUS_high_induction%20widefield%20(1).jpg" onclick="window.location.href = '1384996?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">7-10-FUS_high_induction widefield (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385071/10-7-NICD_high_10_07_2%20(1).jpg" onclick="window.location.href = '1385071?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_high_10_07_2 (1).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385011/10-7-eYFP_high%20(2).jpg" onclick="window.location.href = '1385011?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_high (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385001/7-10-FUS_high_induction%20widefield%20(2).jpg" onclick="window.location.href = '1385001?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">7-10-FUS_high_induction widefield (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385076/10-7-NICD_high_10_07_2%20(2).jpg" onclick="window.location.href = '1385076?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_high_10_07_2 (2).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385016/10-7-eYFP_uninduced%20(1).jpg" onclick="window.location.href = '1385016?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_uninduced (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385051/10-7-FUS_mid_induction-03%20widefield%20(1).jpg" onclick="window.location.href = '1385051?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_mid_induction-03 widefield (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385116/NICD_mid_10_07_2.jpg" onclick="window.location.href = '1385116?op=preview&back_url=1366648'; return false">NICD_mid_10_07_2.jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385021/10-7-eYFP_uninduced%20(2).jpg" onclick="window.location.href = '1385021?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_uninduced (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385056/10-7-FUS_mid_induction-03%20widefield%20(2).jpg" onclick="window.location.href = '1385056?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_mid_induction-03 widefield (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385106/NICD_mid_10_07.jpg" onclick="window.location.href = '1385106?op=preview&back_url=1366648'; return false">NICD_mid_10_07.jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385041/10-7-FUS_low_induction-02%20gfp%20(1).jpg" onclick="window.location.href = '1385041?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_low_induction-02 gfp (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385081/10-7-NICD_low_10_7_2%20(1).jpg" onclick="window.location.href = '1385081?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_low_10_7_2 (1).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385046/10-7-FUS_low_induction-02%20gfp%20(2).jpg" onclick="window.location.href = '1385046?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_low_induction-02 gfp (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385086/10-7-NICD_low_10_7_2%20(2).jpg" onclick="window.location.href = '1385086?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_low_10_7_2 (2).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385061/10-7-FUS_no_induction-03%20widefield%20(1).jpg" onclick="window.location.href = '1385061?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_no_induction-03 widefield (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384986/NICD_unicduced10_7-02.jpg" onclick="window.location.href = '1384986?op=preview&back_url=1366648'; return false">NICD_unicduced10_7-02.jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385066/10-7-FUS_no_induction-03%20widefield%20(2).jpg" onclick="window.location.href = '1385066?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_no_induction-03 widefield (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384991/NICD_uninduced%2010_7.jpg" onclick="window.location.href = '1384991?op=preview&back_url=1366648'; return false">NICD_uninduced 10_7.jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">11/7/19</span></span></span></strong></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Sequencing results show that promoter of the backbones used for the inducible constructs is not AraC but a modified construct. Empty pBad33 plasmid is now </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">sequenced and restriction site cloning prepared.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Also retransformation of pTrc99a was not successful and will be repeated in order to initialize restriction enzyme cloning of the EWSR1 cloning. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Retransformation ptrc and pbad33 empty as well as backbone for receptor</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Pcr of fragments for essays were amplified</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">FRAP was ameliorated with the constitutive SPD5 construct that has been working since the beginning. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">With a pinhole of 65 um, a laser intensity of 100% and 65 itinerations, droplets were bleached and recovery could be observed over time. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><strong>12/7/19</strong></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">13.7.19</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Blade light induction</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">O/N culture with 3 mL of terrific broth</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of OD in the dark with red light lamp. ODs were all 2.0</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Dilution of cutures to OD 0.1</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Incubation for 1,5h hours to reach OD 0.4</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">(ODs were too high, between 0.55 and 0.78) -> dilute</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Split cultures (1.5 mL), half of them in dark tubes (uninduced), half of them in light tubes (induced). </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Transparent tubes were placed in front of blue LED plate (15,5 V) in 37°C shaker. </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">4h incubation/illumination</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">2mL on PBS+Agar plates for microscopy</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New TB medium: 5g NaCl, 10g Bacto Tryptone and 1 mL of NaOH 1M. Autoclaved.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New overnight culture of FUS (ind), SPD5 (ind), NICD (ind) as well as cells with an empty pBAD (negative control) and a mini eYFP plasmid (positive control)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><span lang="EN-GB" style="color:#385723">14. 7.19</span></span></span></span></strong></p>
| + | |
| − | | + | |
| − | <p style="margin:0cm 0cm 8pt"> </p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of the 5 cultures’ OD at 8 am, dilution to OD 0.1.</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">1.5h incubation and measurement of OD. All ODs at 0.4</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Split cultures: </span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">NICD: NICD uninduced, NICD induced (4h light), NICD induced (1 % arabinose)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">FUS: FUS uninduced, FUS induced (4h light), FUS induced (1 % arabinose)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5: SPD5 uninduced, SPD5 induced (4h light), SPD5 induced (1% arabinose)</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Empy pBAD: uninduced / 1% Arabinose</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Mini eYFP: uninduced / 1% Arabinose</span></span></span></p>
| + | |
| − | | + | |
| − | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Incubation for 4 hours. </span></span></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384876/7-14%20mini%20eYFP%20no%20arabinose%20(1).jpg" onclick="window.location.href = '1384876?op=preview&back_url=1366648'; return false">7-14 mini eYFP no arabinose (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384886/7-14-FUS_arabinose-02_2%20(1).jpg" onclick="window.location.href = '1384886?op=preview&back_url=1366648'; return false">7-14-FUS_arabinose-02_2 (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384926/7-14-NICD_Arabinose_2%20(1).jpg" onclick="window.location.href = '1384926?op=preview&back_url=1366648'; return false">7-14-NICD_Arabinose_2 (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384956/7-14-pBAD%20negative%20control%20(1).jpg" onclick="window.location.href = '1384956?op=preview&back_url=1366648'; return false">7-14-pBAD negative control (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384966/7-14-SPD5_arabinose-02_2%20(1).jpg" onclick="window.location.href = '1384966?op=preview&back_url=1366648'; return false">7-14-SPD5_arabinose-02_2 (1).jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384881/7-14%20mini%20eYFP%20no%20arabinose%20(2).jpg" onclick="window.location.href = '1384881?op=preview&back_url=1366648'; return false">7-14 mini eYFP no arabinose (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384891/7-14-FUS_arabinose-02_2%20(2).jpg" onclick="window.location.href = '1384891?op=preview&back_url=1366648'; return false">7-14-FUS_arabinose-02_2 (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384931/7-14-NICD_Arabinose_2%20(2).jpg" onclick="window.location.href = '1384931?op=preview&back_url=1366648'; return false">7-14-NICD_Arabinose_2 (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384961/7-14-pBAD%20negative%20control%20(2).jpg" onclick="window.location.href = '1384961?op=preview&back_url=1366648'; return false">7-14-pBAD negative control (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384851/7-14-SPD5_arabinose-02_2%20(2).jpg" onclick="window.location.href = '1384851?op=preview&back_url=1366648'; return false">7-14-SPD5_arabinose-02_2 (2).jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385126/YFP_high-06.jpg" onclick="window.location.href = '1385126?op=preview&back_url=1366648'; return false">YFP_high-06.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384896/7-14-FUS_light_ind_2%20(1).jpg" onclick="window.location.href = '1384896?op=preview&back_url=1366648'; return false">7-14-FUS_light_ind_2 (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384936/7-14-NICD_light%20induced_2%20(1).jpg" onclick="window.location.href = '1384936?op=preview&back_url=1366648'; return false">7-14-NICD_light induced_2 (1).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384856/7-14-SPD5_light_ind-02_2%20(1).jpg" onclick="window.location.href = '1384856?op=preview&back_url=1366648'; return false">7-14-SPD5_light_ind-02_2 (1).jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385131/YFP_high-06_2.jpg" onclick="window.location.href = '1385131?op=preview&back_url=1366648'; return false">YFP_high-06_2.jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384901/7-14-FUS_light_ind_2%20(2).jpg" onclick="window.location.href = '1384901?op=preview&back_url=1366648'; return false">7-14-FUS_light_ind_2 (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384941/7-14-NICD_light%20induced_2%20(2).jpg" onclick="window.location.href = '1384941?op=preview&back_url=1366648'; return false">7-14-NICD_light induced_2 (2).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384861/7-14-SPD5_light_ind-02_2%20(2).jpg" onclick="window.location.href = '1384861?op=preview&back_url=1366648'; return false">7-14-SPD5_light_ind-02_2 (2).jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384906/7-14-FUS_uninduced-10%20(1).jpg" onclick="window.location.href = '1384906?op=preview&back_url=1366648'; return false">7-14-FUS_uninduced-10 (1).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384946/7-14-NICD_uninducefd-07_2%20(1).jpg" onclick="window.location.href = '1384946?op=preview&back_url=1366648'; return false">7-14-NICD_uninducefd-07_2 (1).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384866/7-14SPD5_unind-05_2%20(1).jpg" onclick="window.location.href = '1384866?op=preview&back_url=1366648'; return false">7-14SPD5_unind-05_2 (1).jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384911/7-14-FUS_uninduced-10%20(2).jpg" onclick="window.location.href = '1384911?op=preview&back_url=1366648'; return false">7-14-FUS_uninduced-10 (2).jpg</a></td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384951/7-14-NICD_uninducefd-07_2%20(2).jpg" onclick="window.location.href = '1384951?op=preview&back_url=1366648'; return false">7-14-NICD_uninducefd-07_2 (2).jpg</a></td>
| + | |
| − | <td> </td>
| + | |
| − | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384871/7-14SPD5_unind-05_2%20(2).jpg" onclick="window.location.href = '1384871?op=preview&back_url=1366648'; return false">7-14SPD5_unind-05_2 (2).jpg</a></td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − |
| + | |
| − | <p> Text </p>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | <div class="labbookentry">
| + | |
| − | <div class="titlewrap">
| + | |
| − | MCP and ms2 cloning and characterization
| + | |
| − | </div>
| + | |
| − | <div class="content">
| + | |
| − | <div class="wrapper">
| + | |
| − | <h2> Subsection Title </h2>
| + | |
| − | <p> Text </p>
| + | |
| − | <h2> Subsection Title #2 </h2>
| + | |
| − | <p> Text </p>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | </div>
| + | |
| − | <div class="labbookentry">
| + | |
| − | <div class="titlewrap">
| + | |
| − | Intein Expression Project
| + | |
| − | </div>
| + | |
| − | <div class="content">
| + | |
| − | <div class="wrapper">
| + | |
| − | <h2>01.07.2019</h2>
| + | |
| − | | + | |
| − | <p class="firstHeading">- PCR of the N-Intein (Npu DnaE, BBa_K1362100)</p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;">- Master Mix (50µL): </span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">10 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19nifwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19nirev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 200-300 pg/µL</td>
| + | |
| − | <td style="text-align: center;">3 µL</td>
| + | |
| − | <td style="text-align: center;">600-900 pg</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">0.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">30.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;">- PCR Programm: </span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">98°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">98°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">54°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>10 sec</p>
| + | |
| − | | + | |
| − | <p>25 sec</p>
| + | |
| − | | + | |
| − | <p>45 sec</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">2 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>02.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- PCR of the C-Intein (Npu DnaE, BBa_K136201)</p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>Master Mix (50µL):</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagents</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">10 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19cifwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19cirev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 200-300 pg/µL</td>
| + | |
| − | <td style="text-align: center;">3 µL</td>
| + | |
| − | <td style="text-align: center;">600-900 pg</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">0.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">30.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>PCR Programm:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">98°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">98°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">56°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>10 sec</p>
| + | |
| − | | + | |
| − | <p>25 sec</p>
| + | |
| − | | + | |
| − | <p>42 sec</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">2 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>- Gelelectrophoresis (1% Agarose, 100 V, 50 min, with Midori Green (3 µL/100 mL):</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;">H2O C-Int</td>
| + | |
| − | <td style="text-align: center;">H2O N-Int</td>
| + | |
| − | <td style="text-align: center;">...</td>
| + | |
| − | <td style="text-align: center;">1 kb ladder</td>
| + | |
| − | <td style="text-align: center;">...</td>
| + | |
| − | <td style="text-align: center;">C-Int</td>
| + | |
| − | <td style="text-align: center;">C-Int</td>
| + | |
| − | <td style="text-align: center;">C-Int</td>
| + | |
| − | <td style="text-align: center;">N-Int</td>
| + | |
| − | <td style="text-align: center;">N-Int</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <div class="centerimgs">
| + | |
| − | <img width="400" src="https://2019.igem.org/wiki/images/8/80/T--Freiburg---Intein_Project-190702_pcr_inteins.png" alt="PCR Gelelctrophoresis of Inteins">
| + | |
| − | </div>
| + | |
| − | | + | |
| − | | + | |
| − | <p>- Gelextraction with <span style="font-size:14px;"> <span style="left: 248.693px; top: 659.552px; font-family: sans-serif; transform: scaleX(1.00055);">NucleoSpin</span><span style="left: 401.4px; top: 657.337px; font-family: sans-serif;">®</span><span style="left: 415.707px; top: 659.552px; font-family: sans-serif; transform: scaleX(1.00046);"> Gel and PCR Clean-up from Machery-Nagel following the protocol (page 19) at:</span></span><br />
| + | |
| − | https://www.mn-net.com/Portals/8/attachments/Redakteure_Bio/Protocols/DNA%20clean-up/UM_PCRcleanup_Gelex_NSGelPCR.pdf</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <h2> </h2>
| + | |
| − | | + | |
| − | <h2>04.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- PCR of pET302 for the C-Intein</p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>Master Mix (50 µL):</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">10 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbcifwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbcirev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 86 ng/µL</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">86 ng</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">0.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">32.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> <span style="font-size:16px;"><strong>PCR Programm:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">98°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">98°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">64°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>10 sec</p>
| + | |
| − | | + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>3 min</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>05.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- PCR of pET302 for N-Intein</p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>Master Mix (50 µL):</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">10 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbnifwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbnirev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 86 ng/µL</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">86 ng</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">0.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">32.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> <span style="font-size:16px;"><strong>PCR Programm:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">98°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">98°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">64°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>10 sec</p>
| + | |
| − | | + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>3 min</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>- Gelelektrophoresis (100 V, 90 min, 1% Agarose, Midori Green 3 µL/100 mL) showed <strong>no bands</strong></p>
| + | |
| − | | + | |
| − | <p>- troubleshooting showed that i used too much DNA</p>
| + | |
| − | | + | |
| − | <p>- Did a gradient PCR for C-Int bb:</p>
| + | |
| − | | + | |
| − | <p>Master Mix 300 µL:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">60 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">6 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbcifwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">15 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbcirev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">15 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 9.8 ng/µL</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">1,96 ng</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">6 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">200 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>- took 50 µL of the mastermix away before adding the DNA to have a H2O control, put the rest in 5 tubes, annealed at the following temperatures:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;">tube 1</td>
| + | |
| − | <td style="text-align: center;">tube 2</td>
| + | |
| − | <td style="text-align: center;">tube 3</td>
| + | |
| − | <td style="text-align: center;">tube4</td>
| + | |
| − | <td style="text-align: center;">tube 5</td>
| + | |
| − | <td style="text-align: center;">H2O tube</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;">55,1°C</td>
| + | |
| − | <td style="text-align: center;">56,8°C</td>
| + | |
| − | <td style="text-align: center;">59,5°C</td>
| + | |
| − | <td style="text-align: center;">61°C</td>
| + | |
| − | <td style="text-align: center;">63,7°C</td>
| + | |
| − | <td style="text-align: center;">63,7°C</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>PCR Programm:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">98°C</td>
| + | |
| − | <td style="text-align: center;">3 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">98°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">- °C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>10 sec</p>
| + | |
| − | | + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>4,5 min</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">4.5 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>06.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- repeated the gradient-PCR with the pET302 for the N-Intein</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>08.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- Gelelektrophoresis (100V, 1% Agarose, 75 min) showed <strong>no bands</strong></p>
| + | |
| − | | + | |
| − | <p>- found out that the touch-down function was activated</p>
| + | |
| − | | + | |
| − | <p>- did a Gradient PCR for the N-Intein Backbone:</p>
| + | |
| − | | + | |
| − | <p>Master Mix 350µL:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">70 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">7 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbnifwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">17.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbnirev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">17.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 9.8 ng/µL (added after taking 50µL of the MM for H<sub>2</sub>O control)</td>
| + | |
| − | <td style="text-align: center;">0.6 µL</td>
| + | |
| − | <td style="text-align: center;">1.96 ng</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">3.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">233.9 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>- took 50 µL of the mastermix away before adding the DNA to have a H2O control, put the rest in 6 tubes, annealed at the following temperatures:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td>tube 1</td>
| + | |
| − | <td>tube 2</td>
| + | |
| − | <td>tube 3</td>
| + | |
| − | <td>tube4</td>
| + | |
| − | <td>tube 5</td>
| + | |
| − | <td>tube 6</td>
| + | |
| − | <td>H2O tube</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>49,2°C</td>
| + | |
| − | <td>51,5°C</td>
| + | |
| − | <td>55,2°C</td>
| + | |
| − | <td>57,3°C</td>
| + | |
| − | <td>61,1°C</td>
| + | |
| − | <td>64,1°C</td>
| + | |
| − | <td>64,1°C</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>PCR Programm:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">96°C</td>
| + | |
| − | <td style="text-align: center;">1 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">96°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">- °C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>4.5 min</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">10 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>09.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- Gelelektrophoresis of the N-Int. BB PCR (100V, 1% Agarose, 75 min, Midori Green (3 µL/100 mL)) showed:</p>
| + | |
| − | | + | |
| − | <div class="centerimgs">
| + | |
| − | <img width="400" src="https://2019.igem.org/wiki/images/f/f0/T--Freiburg---Intein_Project-190709_backbone_n_int.png"
| + | |
| − | alt="Gelelekt. PCR NI BB">
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | | + | |
| − | | + | |
| − | <p>-did a PCR extraction of the tubes of the bands 2,4,5 after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/General_Information/1/high-pure-pcr-product-purification-kit.pdf (page 7)</p>
| + | |
| − | | + | |
| − | <p>- repeated the PCR with the same conditions for the C-Intein BB</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>10.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- Gelelektrophoresis of the C-Int. BB PCR (100V, 1% Agarose, 75 min, Midori Green (3 µL/100 mL)) showed:</p>
| + | |
| − | | + | |
| − | <div class="centerimgs">
| + | |
| − | <img width="400" src="https://2019.igem.org/wiki/images/6/68/T--Freiburg---Intein_Project-190710_backbone_c_int.png">
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <p>- did a PCR extraction of the tubes after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/General_Information/1/high-pure-pcr-product-purification-kit.pdf (page 7)</p>
| + | |
| − | | + | |
| − | <p>- did 2 Gibson assemblys 1 h, 50°C (protocol: https://international.neb.com/protocols/2014/11/26/nebuilder-hifi-dna-assembly-reaction-protocol) with the following amounts of DNA:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td>N-Intein (1464bp)</td>
| + | |
| − | <td>BB for N-Intein (5683bp)</td>
| + | |
| − | <td>C-Intein (1259bp)</td>
| + | |
| − | <td>BB for C-Intein (5682bp)</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>38.64ng</td>
| + | |
| − | <td>50ng</td>
| + | |
| − | <td>33.24ng</td>
| + | |
| − | <td>50ng</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>- did a transformation with competent TOP10 cells following the protocol of: https://international.neb.com/protocols/0001/01/01/high-efficiency-transformation-protocol-c2987</p>
| + | |
| − | | + | |
| − | <p>- platet the cells on Agar plates with Ampicillin and let grow overnight at 37°C</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>11.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- no colonies on the plates</p>
| + | |
| − | | + | |
| − | <p>- did a gelelectrophoresis (1% Agarose, 100 V, 75 min, Midori Green (3 µL/100 mL)) with the following DNA Products:</p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;">ladder</td>
| + | |
| − | <td style="text-align: center;">N-Int</td>
| + | |
| − | <td style="text-align: center;">BB for N-Int</td>
| + | |
| − | <td style="text-align: center;">Gibson BB+N-Int (40ng)</td>
| + | |
| − | <td style="text-align: center;">C-Int</td>
| + | |
| − | <td style="text-align: center;">BB for C-Int</td>
| + | |
| − | <td style="text-align: center;">Gibson BB+C-Int (40ng)</td>
| + | |
| − | <td style="text-align: center;">ladder</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> - had to do a post-staining with Gel-Red (30 min):</p>
| + | |
| − | | + | |
| − | <div class="centerimgs">
| + | |
| − | <img width="400" src="https://2019.igem.org/wiki/images/e/e0/T--Freiburg---Intein_Project-190711_gibson_ints_%2B_bb.png">
| + | |
| − |
| + | |
| − | </div>
| + | |
| − | | + | |
| − | <p>- bands of coiled plasmids can be seen in the top area</p>
| + | |
| − | | + | |
| − | <p>- did another transformation with NEB 5-alpha competent cells following this protocol: https://international.neb.com/protocols/0001/01/01/high-efficiency-transformation-protocol-c2987</p>
| + | |
| − | | + | |
| − | <p>- plated on Agar plates with Ampicillin and let grow overnight at 37°C</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>12.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- colonies did grow overnight and did show red fluorescence as the should with a functioning biobrick inserted into the plasmid</p>
| + | |
| − | | + | |
| − | <p>- picked colonies and let grow overnight at 37°C in 2ml of LB-medium with Ampicillin (100 µg/ml) each</p>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>13.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- cultures did grow well, a miniprep was performed following this protocol: https://files.zymoresearch.com/protocols/_d4208t_d4209_d4210_d4211_d4212_zymopure_plasmid_miniprep.pdf (page 4 + 6)</p>
| + | |
| − | | + | |
| − | <p>- with the harvested plasmids a PCR was performed to insert a point mutation to delete a BsaI restriction site:</p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;">PCR Programm: BsaI point mutation :</span></p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>Master Mix 1 (50µL) each for N-/C-Intein:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">10 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbBsaI mut fwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbBsaI mut rev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 1.2 ng/µL</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">1.2 ng</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">0.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">30.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>DMSO</td>
| + | |
| − | <td style="text-align: center;">2 µL</td>
| + | |
| − | <td style="text-align: center;">4%</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>Master Mix 2 (50µL) each for N-/C-Intein:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">10 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbBsaI mut fwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbBsaI mut rev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">2.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 1.2 ng/µL</td>
| + | |
| − | <td style="text-align: center;">1 µL</td>
| + | |
| − | <td style="text-align: center;">1.2 ng</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">0.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">32.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>PCR Programm:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">96°C</td>
| + | |
| − | <td style="text-align: center;">1.5 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">96°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>35 sec</p>
| + | |
| − | | + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>5 min 45 sec</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">10 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <hr />
| + | |
| − | <p> </p>
| + | |
| − | | + | |
| − | <h2>15.07.2019</h2>
| + | |
| − | | + | |
| − | <p>- did a gelelectrophoresis (1% Agarose, 100 V, 80 min, Midori Green (3 µL/100 mL)), no plasmid bands</p>
| + | |
| − | | + | |
| − | <p>- did a gradient PCR with the N-Intein + BB to get out the BsaI restriction site:</p>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>Master Mix (150µL for 10 tubes):</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" height="187" width="960">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>reagent</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>amount</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>concentration</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>5X Q5 Reaction Buffer</td>
| + | |
| − | <td style="text-align: center;">30 µL</td>
| + | |
| − | <td style="text-align: center;">1X</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>10 mM dNTPs</td>
| + | |
| − | <td style="text-align: center;">3 µL</td>
| + | |
| − | <td style="text-align: center;">200 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbBsaI mut fwd 10<span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">7.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Primer: oIG19bbBsaI mut rev 10 <span style="font-size:16px;">µM</span></td>
| + | |
| − | <td style="text-align: center;">7.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.5 µM</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Template DNA 1.2 ng/µL</td>
| + | |
| − | <td style="text-align: center;">3 µL</td>
| + | |
| − | <td style="text-align: center;">1.2 ng/50 µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Q5 High-Fidelity DNA Polymerase</td>
| + | |
| − | <td style="text-align: center;">1.5 µL</td>
| + | |
| − | <td style="text-align: center;">0.02 U/µL</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Nuclease-Free Water</td>
| + | |
| − | <td style="text-align: center;">97.5 µL</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>Annealing Temperatures: </p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;">tube</td>
| + | |
| − | <td style="text-align: center;">1</td>
| + | |
| − | <td style="text-align: center;">2</td>
| + | |
| − | <td style="text-align: center;">3</td>
| + | |
| − | <td style="text-align: center;">4</td>
| + | |
| − | <td style="text-align: center;">5</td>
| + | |
| − | <td style="text-align: center;">6</td>
| + | |
| − | <td style="text-align: center;">7</td>
| + | |
| − | <td style="text-align: center;">8</td>
| + | |
| − | <td style="text-align: center;">9</td>
| + | |
| − | <td style="text-align: center;">H<sub>2</sub>O</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;">temp.</td>
| + | |
| − | <td style="text-align: center;">55°C</td>
| + | |
| − | <td style="text-align: center;">56.2°C</td>
| + | |
| − | <td style="text-align: center;">57.5°C</td>
| + | |
| − | <td style="text-align: center;">59.4°C</td>
| + | |
| − | <td style="text-align: center;">62°C</td>
| + | |
| − | <td style="text-align: center;">65°C</td>
| + | |
| − | <td style="text-align: center;">67.6°C</td>
| + | |
| − | <td style="text-align: center;">69.5°C</td>
| + | |
| − | <td style="text-align: center;">71.6°C</td>
| + | |
| − | <td style="text-align: center;">71.6°C</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p><span style="font-size:16px;"><strong>PCR Programm:</strong></span></p>
| + | |
| − | | + | |
| − | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;">
| + | |
| − | <tbody>
| + | |
| − | <tr>
| + | |
| − | <td style="text-align: center;"><strong>Step</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Temp.</strong></td>
| + | |
| − | <td style="text-align: center;"><strong>Time</strong></td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Initial Denaturation</td>
| + | |
| − | <td style="text-align: center;">96°C</td>
| + | |
| − | <td style="text-align: center;">1.5 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>
| + | |
| − | <p>Denaturation </p>
| + | |
| − | | + | |
| − | <p>Annealing <em>30x</em></p>
| + | |
| − | | + | |
| − | <p>Extension</p>
| + | |
| − | </td>
| + | |
| − | <td>
| + | |
| − | <p style="text-align: center;">96°C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">- °C</p>
| + | |
| − | | + | |
| − | <p style="text-align: center;">72°C</p>
| + | |
| − | </td>
| + | |
| − | <td style="text-align: center;">
| + | |
| − | <p>35 sec</p>
| + | |
| − | | + | |
| − | <p>30 sec</p>
| + | |
| − | | + | |
| − | <p>5 min 45 sec</p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Final Extension</td>
| + | |
| − | <td style="text-align: center;">72°C</td>
| + | |
| − | <td style="text-align: center;">10 min</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Hold</td>
| + | |
| − | <td style="text-align: center;">4°C</td>
| + | |
| − | <td style="text-align: center;">-</td>
| + | |
| − | </tr>
| + | |
| − | </tbody>
| + | |
| − | </table>
| + | |
| − | | + | |
| − | <p>- Gelelectrophoresis showed no bands</p>
| + | |
| − | | + | |
| − | <p>&n
| + | |
