| Line 7: | Line 7: | ||
<div> Lab Book: Expression </div> | <div> Lab Book: Expression </div> | ||
</div> | </div> | ||
| − | + | <div class="labbook"> | |
<p style="color: black; margin: 0 10%; font-size: 1.6em; padding-bottom: 50px;"> Short description of what has been done </p> | <p style="color: black; margin: 0 10%; font-size: 1.6em; padding-bottom: 50px;"> Short description of what has been done </p> | ||
<div class="labbookentry"> | <div class="labbookentry"> | ||
| Line 16: | Line 16: | ||
<div class="wrapper"> | <div class="wrapper"> | ||
<h2> 04.06.19 </h2> | <h2> 04.06.19 </h2> | ||
| − | + | <p><span style="font-size:14px;">- Made 1:10 dilutions of all primers </span></p> | |
| − | + | ||
| − | + | ||
| + | <table style="border-collapse:collapse; width:1306pt; border:none" > | ||
| + | <colgroup> | ||
| + | <col style="width:110pt" width="147" /> | ||
| + | <col style="width:205pt" width="273" /> | ||
| + | <col style="width:389pt" width="518" /> | ||
| + | <col style="width:436pt" width="582" /> | ||
| + | <col style="width:86pt" width="115" /> | ||
| + | <col style="width:80pt" width="107" /> | ||
| + | </colgroup> | ||
<tbody> | <tbody> | ||
<tr height="24" style="height:18.0pt"> | <tr height="24" style="height:18.0pt"> | ||
| Line 320: | Line 327: | ||
<p>EWSR1 (Ewing Sarcoma Breakpoint Region 1):</p> | <p>EWSR1 (Ewing Sarcoma Breakpoint Region 1):</p> | ||
| − | <span class="wordbreak"> | + | <p><span class="wordbreak"> atggcctcaactgactactccacttactcgcaggcagcagcacagcaaggctacagcgcttatacagcccagccaacgcaaggatatgcccaaacaacgcaggcatacggtcagcagtcttacggcacttacggccagccaactgatgtctcttacactcaagctcagaccacagcgacttatggccagaccgcatatgccacctcttacggtcagcccccgaccgtggaaggaacgtcgactggctatacaactccaaccgctcctcaagcatacagccagccagtccaaggatatggaaccggtgcatacgatacaacaactgccacagtgacgactacacaggcttcttatgcagctcagagtgcatatgggactcaaccagcatacccggcatacggccagcagccagctgcaacagctccaacgcgtcctcaggatggcaacaagccaacagagacctcgcaaccccagtccagtacaggtggctacaatcagccctccttggggtatgggcagagtaactactcgtacccccaagtccccggttcttaccctatgcagcctgtcacggcgcccccgagctatccacctacctcctatagcagtacgcagcccacgtcatatgatcagtcctcatattcccagcaaaacacatatgggcaacctagcagttatggccagcagtcttcgtacgggcagcagtcatcgtatggacagcaacctccgacatcatatccaccacagaccggatcgtactctcaggcaccatcacaatattctcagcaatcatcgtcatacggtcagcagtcttcttttcgtcaggatcatccttcttcgatgggtgtatatggccaagaatcggggggattctctggaccgggtgagaaccgtagtatgtcaggcccagacaaccgtggccgtggtcgtggcggtttcgatcgtggtggcatgtcgcgcggtgggcgtggtgggggccgcgggggtatgggggcaggggagcgtggtgggtttaacaaaccaggtggaccgatggatgagggcccagatcttgacttgggtccaccagtcgatccggatgaggattcagacaatagtgcaatttacgtgcaggggttaaatgactccgtgacgctggatgatctggccgatttcttcaaacaatgcggcgtagtaaaaatgaataaacgcacaggtcaacccatgattcatatctacttggacaaagagactggcaaaccaaaaggagacgctacggtatcatatgaggaccctccaacagctaaagccgctgttgagtggtttgatggaaaagacttccagggaagcaaattaaaggtatcattagcgcgtaaaaaaccacctatgaactcaatgcgcggcggactgccgccccgcgaaggtcgtggtatgccaccgccacttcgtggaggacctggaggtccaggaggtccaggtggtcctatgggacgaatgggaggtcgtggcggcgaccgcgggggttttcctccgcgcgggccccgtggtagtcgtggtaacccttcagggggcggcaacgtgcaacatcgcgcaggcgattggcagtgtccaaacccgggttgcggtaatcagaacttcgcgtggcgtacagaatgtaatcagtgcaaagcgccaaaaccagaaggttttcttccacccccgtttccacctccaggcggagaccgtggccgtggagggccgggtggtatgcgcggcggacgcggaggtcttatggatcgcggtggtccgggcgggatgtttcgtgggggtcgcggcggggatcgtggaggtttccgcggaggtcgcggaatggatcgtggcggattcggaggaggacgtcgtggtggtccaggggggcctcctggtcctctgatggagcagatgggagggcgccgcggtggtcgtggcgggccaggcaagatggataaaggtgagcaccgtcaagagcgccgtgatcgtccctatggaggatccggaggatcc</span></p> |
<p>FUS:</p> | <p>FUS:</p> | ||
| − | <p class="wordbreak">atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac</p> | + | <p><span class="wordbreak">atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac</span></p> |
<p>NICD (Nephrin Intracellular Domain)</p> | <p>NICD (Nephrin Intracellular Domain)</p> | ||
| − | <p class="wordbreak">atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc</p> | + | <p><span class="wordbreak">atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc</span></p> |
<p>SPD5:</p> | <p>SPD5:</p> | ||
| − | <p class="wordbreak"> atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag | + | <p><span class="wordbreak">atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag</span></p> |
| − | </ | + | <table style="border-collapse:collapse; width:379pt; border:none" width="505"> |
| − | + | <colgroup> | |
| − | < | + | <col span="5" style="width:60pt" width="80" /> |
| + | <col style="width:79pt" width="105" /> | ||
| + | </colgroup> | ||
<tbody> | <tbody> | ||
<tr height="19" style="height:14.25pt"> | <tr height="19" style="height:14.25pt"> | ||
| Line 387: | Line 396: | ||
</table> | </table> | ||
| − | + | <img id="spd1" style="width:50%" src="../../imgs/In-Vivo/SPD5.JPG"/> | |
| − | <img id="spd1" src="/imgs/In-Vivo/SPD5.JPG"/> | + | |
<figcaption>Plasmid 3 with split SPD5 gBlock due to its size. Linker for sfGFP is 2xGGS.</figcaption> | <figcaption>Plasmid 3 with split SPD5 gBlock due to its size. Linker for sfGFP is 2xGGS.</figcaption> | ||
</figure> | </figure> | ||
| − | <img id=" | + | <img id="FUS" style="width:50%" src="../../imgs/In-Vivo/FUS.JPG"/> |
<figcaption>Plasmid 2 with Fus. Linker for the sfGFP is 2xGGS</figcaption> | <figcaption>Plasmid 2 with Fus. Linker for the sfGFP is 2xGGS</figcaption> | ||
</figure> | </figure> | ||
| − | <img id=" | + | <img id="spd1" style="width:50%" src="../../imgs/In-Vivo/EWSR1.JPG"/> |
<figcaption>Plasmid 1 with EWSR1. Linker for mCherry is also 2xGGS.</figcaption> | <figcaption>Plasmid 1 with EWSR1. Linker for mCherry is also 2xGGS.</figcaption> | ||
</figure> | </figure> | ||
| − | <img id="nicd" src="/imgs/In-Vivo/NICD.JPG"/> | + | <img id="nicd" style="width:50%" src="../../imgs/In-Vivo/NICD.JPG"/> |
<figcaption>Plasmid 4 with NICD. Linker for sfGFP is 2xGGS</figcaption> | <figcaption>Plasmid 4 with NICD. Linker for sfGFP is 2xGGS</figcaption> | ||
</figure> | </figure> | ||
| Line 407: | Line 415: | ||
<p> </p> | <p> </p> | ||
| − | + | </body> | |
| − | <h2> | + | </html> </p> |
| + | <h2> 05.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Labbook 05.06.2019</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Performed amplifications of the Backbones (all Plasmids will be constructed with a pBAD33 backbone), sfGFP and mCherry genes from plasmids.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Following PCR constructs were made:</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">For FUS: (A) pBAD amplification with Primers 1&2* (not successful)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"> (B) sfGFP amplification with Primers 5&6*</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">For SPD5: (D) pBAD amplification with Primers 7&8* (not successful)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"> (E) sfGFP amplification with Primers 13&14* (not successful)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">For EWSR1: (H) pBAD amplification with Primers 15&16*</span></span></span></p> | ||
| + | |||
| + | <p style="margin-left:35.4pt; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"> (I) mCherry amplification with primers 19&20*</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">*For sequences of primers and roteins see<a href="...%2004.06.19"> Protocol from Day 04.06.2019</a></span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">PCR tubes contained: 2,5 <span style="background:white"><span style="color:#222222">μ</span></span>l of each primer (diluted 1:10)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"> 1 <span style="background:white"><span style="color:#222222">μ</span></span>l DNA </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"> 19 <span style="background:white"><span style="color:#222222">μ</span></span>l H2O</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"> 25 <span style="background:white"><span style="color:#222222">μ</span></span><span lang="EN-GB" style="background:white"><span style="color:#222222">l Phusion Flash Master Mix (Thermo Fisher Scientific) </span></span></span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Fragments B, H and I were successfully amplified, identified via Gel electrophoresis and purified. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><img alt="Pic1" height="616" src="../../imgs/In-Vivo/Unbenannt.JPG" width="573" /></span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><img alt="Pic2" height="272" src="../../imgs/In-Vivo/Unbenannt2.JPG" width="572" /></span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">PCR for DNA fragments A, D and E were set up again. To troubleshoot the PCRS, higher Backbone concentrations of about 2 ng were used. Also for fragment E, 3% of DMSO were added to the PCR mix. Also, two different Polymerases were used (Q5 and Phusion Flash). </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Furthermore, constructs amplifying pBAD33 (A and D) were incubated overnight with 0,5<span style="background:white"><span style="color:#222222">μ</span></span><span lang="EN-GB" style="background:white"><span style="color:#222222">l DPN1 enzyme at 37°C to digest methylated bacterial DNA. </span></span></span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">All amplifications and purifications were successful. Unfortunately, the PCR image has been lost because of technical issues with the GelViewer. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | <h2> 07.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p>NICD (Nephrin Intracellular Domain) was amplified, as well as sfGFP and pBAD33 with respective overlaps. </p> | ||
| + | |||
| + | <p>Following PCRS were set up: </p> | ||
| + | |||
| + | <p>(J) pBAD amplification with primers 1&22*</p> | ||
| + | |||
| + | <p>(K) sfGFP amplification with primers 25&6*</p> | ||
| + | |||
| + | <p>(L) NICD amplification with primers 23&24*</p> | ||
| + | |||
| + | <p>*For all sequences see table in <a href="...%2004.06.19">protocol from 04.06.2019</a></p> | ||
| + | |||
| + | <p>All amplifications were successful, see picture below.</p> | ||
| + | |||
| + | <p><img alt="" height="303" src="../../imgs/In-Vivo/Unbenannt3.JPG" width="411" /></p> | ||
| + | |||
| + | <p>Afterwards, gibson cloning was set up. Considering sizes, amound of insert for 50 ng backbone was calculated.</p> | ||
| + | |||
| + | <p>NICD: 17.6 ng</p> | ||
| + | |||
| + | <p>sfGFP: 24 ng</p> | ||
| + | |||
| + | <p>The DNA was diluted with water until reaching 5 microliters of volume and mixed in a 1:1 ratio with a HiFi ligase/exoniuclease mastermix and incubated at 50°C for 15 minutes. Afterwards competent Top10 E. Coli were transformed with 2 microlitres of Gibson Assembly Mix and incubated overnight. </p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | <h2>11.06.19</h2> | ||
| + | <p><!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p>After transformation of NICD was ineffective, proportions were calculated again and ligation was repeated. Incubation overnight follows.</p> | ||
| + | |||
| + | <p>Furthermore, gBlocks for EWSR1, FUS, SPD5_1 and SPD5_2 were amplified to create overlaps with following Primers:</p> | ||
| + | |||
| + | <p>EWSR1 with Primers 17 and 18*</p> | ||
| + | |||
| + | <p>FUS with Primers 3 and 4*</p> | ||
| + | |||
| + | <p>SPD5_1 and SPD5_2 with Primers 9&10 and 11&12 respectively*</p> | ||
| + | |||
| + | <p>*For primer and protein sequences see <a href="...%2004.06.19">protocol from 04.06.2019.</a></p> | ||
| + | |||
| + | <p>Amplification was only successful for SPD5_2 in the first round:</p> | ||
| + | |||
| + | <p><img alt="" src="./11.06.019%202.JPG" /><img alt="" height="329" src="../../imgs/In-Vivo/11.06.019%202.JPG" width="438" /></p> | ||
| + | |||
| + | <p>PCR troubleshooting consisted of repeating the reaction with two different polymerases, being Q5 and Phusion Flash, as well as adding 3% DMSO to the DNA mix. In the case of EWSR1, DNA was increased to 2 ng.</p> | ||
| + | |||
| + | <p>In the second round, bands for each sequence could be seen, were cut and purified. </p> | ||
| + | |||
| + | <p><img alt="" height="327" src="../../imgs/In-Vivo/11.06.2019.JPG" width="438" /></p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | <h2> 12.06.19 </h2> | ||
| + | <p> Transformation from the day before was unsuccessful, no colonies were on the plate. We found out we used Ampicillin plates, which is the wrong antibiotic. </p> | ||
| + | |||
| + | <p>Since all required sequences for the designed plasmids (for more information about plasmid constructs see protocol from day 04.06.2019) were now amplified, ligation for all plasmids could now start. The method used was Gibson Cloning. The gibson assemblies were then plated on Chloramphenicol plates and incubated overnight.</p> | ||
| + | <h2> 13.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p>Gibson assembly of the Plasmids containing NICD and SPD5, EWSR.</p> | ||
| + | |||
| + | <p>Following constructs were ligated with NEB HiFi Ligase:</p> | ||
| + | |||
| + | <p>Fus: A + B + C (Fus)</p> | ||
| + | |||
| + | <p>EWSR1: H, I, J (EWSR1)</p> | ||
| + | |||
| + | <p>SPD5: D, E, F(SPD5_1) and G (SPD5_2)</p> | ||
| + | |||
| + | <p>Together with the ligated NICD plasmid, all plasmids were transformed into competent E. Coli and plated on chloramphenicol plates.</p> | ||
| + | |||
| + | <p>Plates were incubated overnight at 37°C</p> | ||
| + | </body> | ||
| + | </html></p> | ||
| + | <h2> 14.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p>Plates containing FUS, SPD5 and NICD from 13.06.2019 had colonies. EWSR1 had no colonies.</p> | ||
| + | |||
| + | <p>Coloies were picked and LB medium with Chloramphenicol was inoculated, bacteria was grown in media for 5 hours and prepared for sequencing. </p> | ||
| + | |||
| + | <p>A second set of media were incoulated and prepared for microscopy. Samples were visualized with a Widefield microscope and analyzed with FiJi. Images attached.</p> | ||
| + | |||
| + | <p> </p> | ||
| + | |||
| + | <p>SPD5 sample 2: Dispersed fluroescence (left). No indication for droplets found.</p> | ||
| + | |||
| + | <p><img alt="" height="345" src="../../imgs/In-Vivo/SPD5_1-04.jpg" width="430" /><img alt="" height="344" src="../../imgs/In-Vivo/SPD5_1-04_02.jpg" width="430" /></p> | ||
| + | |||
| + | <p>SPD5 sample 1. Lighter spots that can be an indication for droplets in the fluorescent image (Left) that are not visible on the right.</p> | ||
| + | |||
| + | <p><img alt="" height="343" src="../../imgs/In-Vivo/SPD5_1-02.jpg" width="427" /><img alt="" height="342" src="../../imgs/In-Vivo/SPD5_1-02_02.jpg" width="426" /></p> | ||
| + | |||
| + | <p>FUS sample 1. Low, dispersed fluorescence (left). No indications for droplets.</p> | ||
| + | |||
| + | <p><img alt="" height="343" src="../../imgs/In-Vivo/FUS_2-03.jpg" width="427" /><img alt="" height="343" src="../../imgs/In-Vivo/FUS_2-03_02.jpg" width="428" /></p> | ||
| + | |||
| + | <p>NICD sample 1. Low, dispersed fluorescence (left). No indications for droplets.</p> | ||
| + | |||
| + | <p><img alt="" height="342" src="../../imgs/In-Vivo/NICD_2-06.jpg" width="426" /><img alt="" height="341" src="../../imgs/In-Vivo/NICD_2-06_02.jpg" width="425" /></p> | ||
| + | |||
| + | <p>Problem with NICD: A cloning mistake has led to an excessive atg start codon at the begining of sfGFP, which may give misleading results.</p> | ||
| + | |||
| + | <p>Complementary primers for a site directed mutagenesis deleting the excessive three bases were ordered. </p> | ||
| + | |||
| + | <p><img alt="" height="318" src="../../imgs/In-Vivo/atg.JPG" width="321" /></p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | <h2> 20.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p>Criteria for identifying if an accumulation of fluorescent proteins are dynamic droplets or dead aggregates:</p> | ||
| + | |||
| + | <p>1. They appear in a concentration dependent manner,</p> | ||
| + | |||
| + | <p>2. They fuse when they encounter another one of their kind,</p> | ||
| + | |||
| + | <p>3. Fluorescence regeneraties after photobleaching (FRAP)</p> | ||
| + | |||
| + | <p>In order to determine whether the results seen in the last protocol are significant, the constructed proteins have to be inducible to be seen under different concentrations.</p> | ||
| + | |||
| + | <p>Cloning steps were repeated so that the constructs could be positioned in front of inducible promoters. Additionally, EWSR1 will be inserted in a different backbone with</p> | ||
| + | |||
| + | <p>compatible origins of replications with the pBAD backbone, so that FUS and EWSR1 can be induced in the same bacteria without competition. The new backbone for </p> | ||
| + | |||
| + | <p>EWSR1 is pTrc99a (empty) with a prc promoter.</p> | ||
| + | |||
| + | <p>Following primers are now added to the list:</p> | ||
| + | |||
| + | <table style="border-collapse:collapse; width:1041pt; border:none" width="1389"> | ||
| + | <colgroup> | ||
| + | <col style="width:60pt" width="80" /> | ||
| + | <col style="width:136pt" width="182" /> | ||
| + | <col style="width:204pt" width="272" /> | ||
| + | <col style="width:311pt" width="415" /> | ||
| + | <col style="width:330pt" width="440" /> | ||
| + | </colgroup> | ||
| + | <tbody> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td height="19" style="border:none; height:14.25pt; width:60pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="80"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">New primers</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; width:136pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="182"> </td> | ||
| + | <td style="border:none; width:204pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="272"> </td> | ||
| + | <td style="border:none; width:311pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="415"> </td> | ||
| + | <td style="border:none; width:330pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="440"> </td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Number</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Name</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Tube name</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Sequence</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Description</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">31</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">TGGATGAGCTCTACAAATAA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">AAGCTTGGCTGTTTTGGCGG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">32</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_SPD5_REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">AGGACAGAGTTATCTTCCAT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TCTAGAGGATCCCCGGGTAC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">32_2</span></span></span></span></span></span></td> | ||
| + | <td class="xl70" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_1_mid_GFP_rev</span></span></span></span></span></span></td> | ||
| + | <td class="xl70" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_1_mid_GFP_rev</span></span></span></span></span></span></td> | ||
| + | <td class="xl72" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GTGCAATAGT<font><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">GAAACGACGCGACGC</span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif"> </span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">33</span></span></span></span></span></span></td> | ||
| + | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl73" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GTACCCGGGGATCCTCTAGA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">ATGGAAGATAACTCTGTCCTTAA</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify SPD5_1 with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">34</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">SPD5_sfGFP_pBAD33 REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CCGCCAAAACAGCCAAGCTT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TTATTTGTAGAGCTCATCCATGC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify GFP with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">35</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CATGGAATTCGAGCTCGGTA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">ATGGCCTCAACTGACTACTC</span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify EWSR1 with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">36</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">EWSR1_mCherry_pBAD33 REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GACTCTAGAGGATCCCCGGG<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TTAGTACAGCTCGTCCATGC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify mCherry with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">37</span></span></span></span></span></span></td> | ||
| + | <td class="xl74" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:700"><span style="font-family:Arial,sans-serif"><span style="font-style:normal"><span style="text-decoration:none"> <font><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">pTrc99A FWD</span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl74" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:700"><span style="font-family:Arial,sans-serif"><span style="font-style:normal"><span style="text-decoration:none"> <font><span style="font-size:10pt"><span style="color:#333333"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">pTrc99A FWD</span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GCATGGACGAGCTGTACTAA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">CCCGGGGATCCTCTAGAGTC</span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify pTrc99A (induceable promoter) with right overlaps</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">38</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pTrc99A REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pTrc99A REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GAGTAGTCAGTTGAGGCCAT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TACCGAGCTCGAATTCCATG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify pTrc99A (induceable promoter) with right overlaps</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">39</span></span></span></span></span></span></td> | ||
| + | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33_FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl71" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33_FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl73" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">GTACCCGGGGATCCTCTAGA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">ATGAATGCGTCATGTGTAGG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify NICD with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td class="xl69" height="19" style="border:none; background:#ffe699; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">39_2</span></span></span></span></span></span></td> | ||
| + | <td class="xl75" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_mid_sfGFP_REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl70" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#344043"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_mid_sfGFP_REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl72" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">TCCTTTGCTCAT<font><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">GGATCCTCCGGATCCTC</span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl69" style="border:none; background:#ffe699; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify NICD with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">40</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33 REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">NICD_sfGFP_pBAD33 REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CCGCCAAAACAGCCAAGCTT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TTATTTGTAGAGCTCATCCATGC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify sfGFP with the right overlap for new backbone</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">41</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD FWD</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">TGGATGAGCTCTACAAATAA<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">AAGCTTGGCTGTTTTGGCGG</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl66" height="19" style="border:none; background:#e2efda; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">42</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl67" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pBAD33wt_NICD REV</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">CCTACACATGACGCATTCAT<font><span style="font-size:10pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif">TCTAGAGGATCCCCGGGTAC</span></span></span></span></span></span></font><font><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Arial,sans-serif"> </span></span></span></span></span></span></font></span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; background:#e2efda; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primer to amplify new pBAD33(induceable promoter) with right overlaps</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | </tr> | ||
| + | <tr height="21" style="height:15.75pt"> | ||
| + | <td height="21" style="border:none; height:15.75pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td class="xl63" colspan="2" style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:12pt"><span style="color:#333333"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">Primers for NICD atg deletion</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td height="19" style="border:none; height:14.25pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">atg_del_fwd</span></span></span></span></span></span></td> | ||
| + | <td class="xl64" style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">GATCCGGAGGATCCAGCAAAGGAGAAGAAC</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | </tr> | ||
| + | <tr height="21" style="height:15.75pt"> | ||
| + | <td height="21" style="border:none; height:15.75pt; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">atg_del_Rev</span></span></span></span></span></span></td> | ||
| + | <td class="xl65" style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:12pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">GTTCTTCTCCTTTGCTGGATCCTCCGGATC </span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"> </td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p> </p> | ||
| + | |||
| + | <p>Constructs cotnaining the backbone with inducible promoters will be the following:</p> | ||
| + | |||
| + | <p>FUS, containing the following fragments</p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td>XA</td> | ||
| + | <td>pBAD</td> | ||
| + | <td>w/primers 29&30</td> | ||
| + | <td>68°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XB</td> | ||
| + | <td>GFP</td> | ||
| + | <td>w/ primers 5&28</td> | ||
| + | <td>63°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XC</td> | ||
| + | <td>FUS</td> | ||
| + | <td>w/ primers 27&4</td> | ||
| + | <td>68°C</td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p> </p> | ||
| + | |||
| + | <p>SPD5, containing the following fragments</p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td>XD</td> | ||
| + | <td>pBAD</td> | ||
| + | <td>w/primers 31&32</td> | ||
| + | <td>68°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XE</td> | ||
| + | <td>GFP</td> | ||
| + | <td>w/primers 13&34</td> | ||
| + | <td>63°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XF</td> | ||
| + | <td>SPD1</td> | ||
| + | <td>w/primers 33&10</td> | ||
| + | <td>60°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>G</td> | ||
| + | <td>SPD2</td> | ||
| + | <td> </td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p>EWSR1, containing the following fragments:</p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td>XG</td> | ||
| + | <td>pBAD</td> | ||
| + | <td>w/primers 37&38</td> | ||
| + | <td>65°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XH</td> | ||
| + | <td>EWSR1</td> | ||
| + | <td>w/primers 35&18</td> | ||
| + | <td>65°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XI</td> | ||
| + | <td>mCherry</td> | ||
| + | <td>w/primers 19&36</td> | ||
| + | <td>65°C</td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p>NICD, containing the following fragments:</p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td>XJ</td> | ||
| + | <td>pBAD</td> | ||
| + | <td>w/primers 41&42</td> | ||
| + | <td>68°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XK</td> | ||
| + | <td>sfGFP</td> | ||
| + | <td>w/primers 25&40</td> | ||
| + | <td>63°C</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>XL</td> | ||
| + | <td>NICD</td> | ||
| + | <td>w/primers 39&24</td> | ||
| + | <td>63°C</td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p> </p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | <h2> 21.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <p>Amplifications for the gibson fragments with corrresponding sticky ends were started in order to achieve plasmids with the constructs in front of inducible promoters.</p> | ||
| + | |||
| + | <p><img alt="" height="338" src="../../imgs/In-Vivo/PCR.JPG" width="516" /><img alt="" height="334" src="../../imgs/In-Vivo/PCRteil2.JPG" width="561" /></p> | ||
| + | |||
| + | <p>Image left and right: 1% agarose gel with results of amplification of gibson fragments. </p> | ||
| + | |||
| + | <p>All Fragments except EWSR1 gBlock could be successfully amplified. New primers were ordered as part of the troubleshooting procedure. </p> | ||
| + | |||
| + | <p>The new primers are:</p> | ||
| + | |||
| + | <table style="border-collapse:collapse; width:777pt; border:none" width="1036"> | ||
| + | <colgroup> | ||
| + | <col style="width:60pt" width="80" /> | ||
| + | <col style="width:158pt" width="211" /> | ||
| + | <col style="width:216pt" width="288" /> | ||
| + | <col style="width:343pt" width="457" /> | ||
| + | </colgroup> | ||
| + | <tbody> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl63" height="19" style="border:none; border-bottom:none; height:14.25pt; width:60pt; border-top:1pt solid windowtext; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="80"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">43</span></span></span></span></span></span></td> | ||
| + | <td class="xl64" style="border:none; border-bottom:none; width:158pt; border-top:1pt solid windowtext; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="211"><span style="font-size:10pt"><span style="color:#333333"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">pTrc99a_rev</span></span></span></span></span></span></td> | ||
| + | <td class="xl65" style="border:none; border-bottom:none; width:216pt; border-top:1pt solid windowtext; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="288"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">pTrc99a_inducible_rev, </span></span></span></span></span></span></td> | ||
| + | <td class="xl66" style="border:none; border-bottom:none; width:343pt; border-top:1pt solid windowtext; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap" width="457"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">ttgaggccatTACCGAGCTCGAATTCCATG</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">44</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_fwd</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_inducible_fwd,</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">gagctcggtaATGGCCTCAACTGACTACTC</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">45</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_rev</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">EWSR1_inducible_rev</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">46</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_fwd</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_inducible_fwd</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="19" style="height:14.25pt"> | ||
| + | <td align="right" class="xl67" height="19" style="border:none; border-bottom:none; height:14.25pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">47</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_rev</span></span></span></span></span></span></td> | ||
| + | <td style="border:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">mCherry_inducible_rev,</span></span></span></span></span></span></td> | ||
| + | <td class="xl68" style="border:none; border-bottom:none; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">gatccccgggGTACAGCTCGTCCATGCC</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | <tr height="20" style="height:14.65pt"> | ||
| + | <td align="right" class="xl69" height="20" style="border:none; border-bottom:1pt solid windowtext; height:14.65pt; border-top:none; border-right:none; border-left:1pt solid windowtext; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">48</span></span></span></span></span></span></td> | ||
| + | <td class="xl70" style="border:none; border-bottom:1pt solid windowtext; border-top:none; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">pTrc99a_fwd</span></span></span></span></span></span></td> | ||
| + | <td class="xl70" style="border:none; border-bottom:1pt solid windowtext; border-top:none; border-right:none; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:11pt"><span style="color:black"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none"><span style="font-family:Calibri,sans-serif">pTrc99a_inducible_fwd</span></span></span></span></span></span></td> | ||
| + | <td class="xl71" style="border:none; border-bottom:1pt solid windowtext; border-top:none; border-right:1pt solid windowtext; border-left:none; padding-top:1px; padding-right:1px; padding-left:1px; vertical-align:bottom; white-space:nowrap"><span style="font-size:10pt"><span style="color:#a2b9be"><span style="font-family:Arial,sans-serif"><span style="font-weight:400"><span style="font-style:normal"><span style="text-decoration:none">cgagctgtacCCCGGGGATCCTCTAGAG</span></span></span></span></span></span></td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p> </p> | ||
| + | |||
| + | <p> </p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | <h2> 25.06.19 </h2> | ||
| + | <p> <!DOCTYPE html> | ||
| + | <html> | ||
| + | <head><meta charset="utf-8"> | ||
| + | <title></title> | ||
| + | </head> | ||
| + | <body> | ||
| + | <h3 style="margin: 0cm 0cm 8pt;"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Labbook </span></span></span></strong></h3> | ||
| + | |||
| + | <h3 style="margin: 0cm 0cm 8pt;"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">25/6/19</span></span></span></strong></h3> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR for SPD5_1 and FUS and NICD with new primers and extract from agarose gel. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Transform into competent cells and grow overnight culture.</span></span></span></p> | ||
| + | |||
| + | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">26/6/19</span></span></span></h2> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Planning of FRAP experiment</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Widefield and Brightfield microscopy of samples </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Gibson assembly of FUSinducible (XA, XB, XC) </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">50 ng of Backbone (1uL) </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">50 ng sfGFP (2,78 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">73 ng FUS (0.73 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Retransformation of bacteria with correctly sequenced constructs (constitutive)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR for NICD and SPD5 fragments</span></span></span></p> | ||
| + | |||
| + | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">27/6/19</span></span></span></h2> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Miniprep of assembled FUS </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR of fragments XC, XF, XL, XH and HI (not successful except XC, XF)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Repeat PCR of fragments XH XI and XL with 3% DMSO</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Gibson assembly of NICD and SPD5 with correct amplified fragments.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">NICD: 50 ng Backbone (0,63 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">23,86 ng sfGFP (2,06 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">51,14 ng NICD (2,60 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5: 50 ng Backbone (2.5 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">sfGFP: 24,68 ng (1,1 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5_1: 68,18 (4,54 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5_2: 51,14 (1,17 uL)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">2/7/19</span></span></span></h2> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">PCR of EWSR1 with primers 17&18, 18&35 and 44&45 in order to amplify EWSR1 constitutive and EWSR1 inducible (twice) </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">PCR was not successful. Next step is a Touchdown PCR starting at 75°C and going down to 65°C (annealing temperature of the three constructs)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Induceable constructs were retransformed (NICD was made again by Gibson assembly)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Constitutive constructs were retransformed. All retranformations were plated on Chloramphenicol plates and placed overnight in the 37°C incubator. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">3/7/19</span></span></span></h2> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Colonies were picked and new overnight cultures were prepared from the retransformation of the constructs (induceable and constitutive) for the FRAP experiment.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New Glycerol stocks from all constructs were frozen at -80°C</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Glucose free TB medium was mixed, heated and autoclaved in order to prepare the induction and FRAP experiment.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New Chloramphenicol plates were made (LB medium + 400uL 34g/mol Chloramphenicol stock solution added at 50°C)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <h2 style="margin: 0cm 0cm 8pt;"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">4/7/19</span></span></span></h2> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Microscopy of the working constructs (constitutive FUS, NICD and SPD5 as well as Arbinose-inducible FUS, NICD and SPD5) and the negative control IPTG-inducible</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">mini eYFP which is known to form aggregates at high concentrations (source: AG Di Ventura, BIOSS Freiburg).</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Induction was carried out with the following concentrations:</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">No induction: E. coli carrying plasmids were grown overnight in TB, diluted to OD 0.01 in the morning, grown to OD 0.5 and further incubated for 2h at 37°C with vigorous shaking.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Induction: E. coli were grown in overnight culture in TB medium, diluted to OD 0.01 in the morning, grown to OD 0.5 and induced with the following concentrations of Arabinose:</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">LOW: 0.001% Arabinose</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">MID: 0.05% Arabinose</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">HIGH: 1% Arabinose</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">After 2h in the incubater at 37°C and vigorous shaking, miscroscopy was carried out.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">At first, samples were analysed with brightfield and widefield GFP microscopy. Cells were checked for droplet like dots. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Most cells didn’t show droplet-like structures, only constitutive SPD5 (as already shown before). Induction seemed to not have worked, since the positive control </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">plasmid mini eYFP did not show the expected results. Furthermore, general fluorescence of mid and high induced cells was not to be distinguished from low induced cells in most cases. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">The constitutive SPD5 probe containing droplet-like structures was analysed under the confocal microscope at 100x. Bleaching was done with 100% laser </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">intensity with an itinerary of 20. Single droplet like structures were bleached and the Region of Interest (ROI) was analysed, while other ROIs were only analised. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Results did not seem to be clear. Induceable constructs are analysed (sequenced) and microscopy will be repeated in a week. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385136/FUS_const_04_07.jpg" onclick="window.location.href = '1385136?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_const_04_07.jpg</a> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385191/NICD_cons_04_07.jpg" onclick="window.location.href = '1385191?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_cons_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385231/SPD5_const_04_07.jpg" onclick="window.location.href = '1385231?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_const_04_07.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> | ||
| + | <p style="margin:0cm 0cm 8pt"><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385141/FUS_const_04_07_2.jpg" onclick="window.location.href = '1385141?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_const_04_07_2.jpg</a> </p> | ||
| + | </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385196/NICD_const_04_07_2.jpg" onclick="window.location.href = '1385196?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_const_04_07_2.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385236/SPD5_const_04_07_2.jpg" onclick="window.location.href = '1385236?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_const_04_07_2.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385146/FUS_high_04_07.jpg" onclick="window.location.href = '1385146?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_high_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385201/NICD_high%2010_07.jpg" onclick="window.location.href = '1385201?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_high 10_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385241/SPD5_high_04_07.jpg" onclick="window.location.href = '1385241?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_high_04_07.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385151/FUS_high_04_07_2.jpg" onclick="window.location.href = '1385151?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_high_04_07_2.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385206/NICD_high_04_07.jpg" onclick="window.location.href = '1385206?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_high_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385246/SPD5_high_04_07_2.jpg" onclick="window.location.href = '1385246?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_high_04_07_2.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385166/FUS_mid_04_07.jpg" onclick="window.location.href = '1385166?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_mid_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385226/NICD_mid_04_07.jpg" onclick="window.location.href = '1385226?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_mid_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385261/SPD5_mid_04_07_2.jpg" onclick="window.location.href = '1385261?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_mid_04_07_2.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385171/FUS_mid_04_07_2.jpg" onclick="window.location.href = '1385171?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_mid_04_07_2.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385106/NICD_mid_10_07.jpg" onclick="window.location.href = '1385106?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_mid_10_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385266/SPD5_mod_04_07.jpg" onclick="window.location.href = '1385266?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_mod_04_07.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385156/FUS_low_04_07.jpg" onclick="window.location.href = '1385156?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_low_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385216/NICD_Low_04_07.jpg" onclick="window.location.href = '1385216?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_Low_04_07.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385251/SPD5_low_04_07.jpg" onclick="window.location.href = '1385251?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_low_04_07.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385161/FUS_low_04_07_2.jpg" onclick="window.location.href = '1385161?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">FUS_low_04_07_2.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385221/NICD_Low_04_07_1.jpg" onclick="window.location.href = '1385221?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">NICD_Low_04_07_1.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385256/SPD5_low_04_07_2.jpg" onclick="window.location.href = '1385256?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">SPD5_low_04_07_2.jpg</a></td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><u><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">8/7/19</span></span></span></strong></u></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Touchdown PCR was started with the EWSR1 constructs, amplified with primer pairs 17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">9/7/19 </span></span></span></strong></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Ordered new gBlocks at twist. Ewsr in two parts. 999bp and 1002bp.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Made new TB buffer.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New cloning for EWSR1:</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Kinase reaction on the insert with T4 polynucleotide kinase </b></span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Find restriction enzymes</b></span></span></span></p> | ||
| + | |||
| + | <ol> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>pTrc99a empty: digest with sma1 (2h)</b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Inactivation wth heat (check temperature in NEB): 65°C 20 min</b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Column purification of the digested backbone: elute in 20uL of water</b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Measure concentration: take 30-50 ng of template</b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Take 150 ng of the gblock</b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Ligation overnight 4°C with ligase </b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 0.0001pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Transform 50uL and plate</b></span></span></span></li> | ||
| + | <li style="margin:0cm 0cm 8pt 36pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><b>Colony PCR to verify (try 10 colonies at first)</b></span></span></span></li> | ||
| + | </ol> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Overnight culture in TB medium of constructs FUS3 ind (verified by sequencing), SPD5_1 ind (verified by sequencing) and NICD (not verified) and mini eYFP construct.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New constructs were sent for sequencing</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">10/7/19</span></span></span></strong></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Retransformation of pTrc99a </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">All cultures were split and induced with different levels of arabinose:</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">NICD: NICD uninduced, NICD low (0.001%), NICD mid (0.05 %) and high (1%)</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">FUS: FUS uninduced, FUS low (0.001%), FUS mid (0.05 %) and high (1%)</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5: SPD5 uninduced, SPD5 low (0.001%), SPD5 mid (0.05 %) and high (1%)</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Control: mini eYFP uninduced and induced with 1 mM IPTG</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span lang="EN-GB" style="font-size:11.0pt"><span style="line-height:107%"><span style="font-family:"Calibri",sans-serif">None of the transformations were successful.</span></span></span></p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385026/10-7-FUS_constitutive%20(1).jpg" onclick="window.location.href = '1385026?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_constitutive (1).jpg</a></td> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385101/10-7-SPD5_constitutive-04.jpg" onclick="window.location.href = '1385101?op=preview&back_url=1366648'; return false">10-7-SPD5_constitutive-04.jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385031/10-7-FUS_constitutive%20(2).jpg" onclick="window.location.href = '1385031?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_constitutive (2).jpg</a></td> | ||
| + | <td> </td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385006/10-7-eYFP_high%20(1).jpg" onclick="window.location.href = '1385006?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_high (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384996/7-10-FUS_high_induction%20widefield%20(1).jpg" onclick="window.location.href = '1384996?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">7-10-FUS_high_induction widefield (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385071/10-7-NICD_high_10_07_2%20(1).jpg" onclick="window.location.href = '1385071?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_high_10_07_2 (1).jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385011/10-7-eYFP_high%20(2).jpg" onclick="window.location.href = '1385011?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_high (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385001/7-10-FUS_high_induction%20widefield%20(2).jpg" onclick="window.location.href = '1385001?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">7-10-FUS_high_induction widefield (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385076/10-7-NICD_high_10_07_2%20(2).jpg" onclick="window.location.href = '1385076?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_high_10_07_2 (2).jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385016/10-7-eYFP_uninduced%20(1).jpg" onclick="window.location.href = '1385016?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_uninduced (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385051/10-7-FUS_mid_induction-03%20widefield%20(1).jpg" onclick="window.location.href = '1385051?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_mid_induction-03 widefield (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385116/NICD_mid_10_07_2.jpg" onclick="window.location.href = '1385116?op=preview&back_url=1366648'; return false">NICD_mid_10_07_2.jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385021/10-7-eYFP_uninduced%20(2).jpg" onclick="window.location.href = '1385021?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-eYFP_uninduced (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385056/10-7-FUS_mid_induction-03%20widefield%20(2).jpg" onclick="window.location.href = '1385056?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_mid_induction-03 widefield (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385106/NICD_mid_10_07.jpg" onclick="window.location.href = '1385106?op=preview&back_url=1366648'; return false">NICD_mid_10_07.jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385041/10-7-FUS_low_induction-02%20gfp%20(1).jpg" onclick="window.location.href = '1385041?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_low_induction-02 gfp (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385081/10-7-NICD_low_10_7_2%20(1).jpg" onclick="window.location.href = '1385081?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_low_10_7_2 (1).jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385046/10-7-FUS_low_induction-02%20gfp%20(2).jpg" onclick="window.location.href = '1385046?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_low_induction-02 gfp (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385086/10-7-NICD_low_10_7_2%20(2).jpg" onclick="window.location.href = '1385086?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-NICD_low_10_7_2 (2).jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385061/10-7-FUS_no_induction-03%20widefield%20(1).jpg" onclick="window.location.href = '1385061?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_no_induction-03 widefield (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384986/NICD_unicduced10_7-02.jpg" onclick="window.location.href = '1384986?op=preview&back_url=1366648'; return false">NICD_unicduced10_7-02.jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385066/10-7-FUS_no_induction-03%20widefield%20(2).jpg" onclick="window.location.href = '1385066?op=preview&back_url=1366648%3fclient_size%3d544x710'; return false">10-7-FUS_no_induction-03 widefield (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384991/NICD_uninduced%2010_7.jpg" onclick="window.location.href = '1384991?op=preview&back_url=1366648'; return false">NICD_uninduced 10_7.jpg</a></td> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">11/7/19</span></span></span></strong></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Sequencing results show that promoter of the backbones used for the inducible constructs is not AraC but a modified construct. Empty pBad33 plasmid is now </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">sequenced and restriction site cloning prepared.</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Also retransformation of pTrc99a was not successful and will be repeated in order to initialize restriction enzyme cloning of the EWSR1 cloning. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Retransformation ptrc and pbad33 empty as well as backbone for receptor</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Pcr of fragments for essays were amplified</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">FRAP was ameliorated with the constitutive SPD5 construct that has been working since the beginning. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">With a pinhole of 65 um, a laser intensity of 100% and 65 itinerations, droplets were bleached and recovery could be observed over time. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><strong>12/7/19</strong></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">13.7.19</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Blade light induction</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">O/N culture with 3 mL of terrific broth</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of OD in the dark with red light lamp. ODs were all 2.0</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Dilution of cutures to OD 0.1</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Incubation for 1,5h hours to reach OD 0.4</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">(ODs were too high, between 0.55 and 0.78) -> dilute</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Split cultures (1.5 mL), half of them in dark tubes (uninduced), half of them in light tubes (induced). </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Transparent tubes were placed in front of blue LED plate (15,5 V) in 37°C shaker. </span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">4h incubation/illumination</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">2mL on PBS+Agar plates for microscopy</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New TB medium: 5g NaCl, 10g Bacto Tryptone and 1 mL of NaOH 1M. Autoclaved.</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">New overnight culture of FUS (ind), SPD5 (ind), NICD (ind) as well as cells with an empty pBAD (negative control) and a mini eYFP plasmid (positive control)</span></span></span></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"><strong><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif"><span lang="EN-GB" style="color:#385723">14. 7.19</span></span></span></span></strong></p> | ||
| + | |||
| + | <p style="margin:0cm 0cm 8pt"> </p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Measurement of the 5 cultures’ OD at 8 am, dilution to OD 0.1.</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">1.5h incubation and measurement of OD. All ODs at 0.4</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Split cultures: </span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">NICD: NICD uninduced, NICD induced (4h light), NICD induced (1 % arabinose)</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">FUS: FUS uninduced, FUS induced (4h light), FUS induced (1 % arabinose)</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">SPD5: SPD5 uninduced, SPD5 induced (4h light), SPD5 induced (1% arabinose)</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Empy pBAD: uninduced / 1% Arabinose</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Mini eYFP: uninduced / 1% Arabinose</span></span></span></p> | ||
| + | |||
| + | <p style="text-align:justify; margin:0cm 0cm 8pt"><span style="font-size:11pt"><span style="line-height:107%"><span style="font-family:Calibri,sans-serif">Incubation for 4 hours. </span></span></span></p> | ||
| + | |||
| + | <table border="1" cellpadding="1" cellspacing="1" style="width: 960px;"> | ||
| + | <tbody> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384876/7-14%20mini%20eYFP%20no%20arabinose%20(1).jpg" onclick="window.location.href = '1384876?op=preview&back_url=1366648'; return false">7-14 mini eYFP no arabinose (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384886/7-14-FUS_arabinose-02_2%20(1).jpg" onclick="window.location.href = '1384886?op=preview&back_url=1366648'; return false">7-14-FUS_arabinose-02_2 (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384926/7-14-NICD_Arabinose_2%20(1).jpg" onclick="window.location.href = '1384926?op=preview&back_url=1366648'; return false">7-14-NICD_Arabinose_2 (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384956/7-14-pBAD%20negative%20control%20(1).jpg" onclick="window.location.href = '1384956?op=preview&back_url=1366648'; return false">7-14-pBAD negative control (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384966/7-14-SPD5_arabinose-02_2%20(1).jpg" onclick="window.location.href = '1384966?op=preview&back_url=1366648'; return false">7-14-SPD5_arabinose-02_2 (1).jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384881/7-14%20mini%20eYFP%20no%20arabinose%20(2).jpg" onclick="window.location.href = '1384881?op=preview&back_url=1366648'; return false">7-14 mini eYFP no arabinose (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384891/7-14-FUS_arabinose-02_2%20(2).jpg" onclick="window.location.href = '1384891?op=preview&back_url=1366648'; return false">7-14-FUS_arabinose-02_2 (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384931/7-14-NICD_Arabinose_2%20(2).jpg" onclick="window.location.href = '1384931?op=preview&back_url=1366648'; return false">7-14-NICD_Arabinose_2 (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384961/7-14-pBAD%20negative%20control%20(2).jpg" onclick="window.location.href = '1384961?op=preview&back_url=1366648'; return false">7-14-pBAD negative control (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384851/7-14-SPD5_arabinose-02_2%20(2).jpg" onclick="window.location.href = '1384851?op=preview&back_url=1366648'; return false">7-14-SPD5_arabinose-02_2 (2).jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385126/YFP_high-06.jpg" onclick="window.location.href = '1385126?op=preview&back_url=1366648'; return false">YFP_high-06.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384896/7-14-FUS_light_ind_2%20(1).jpg" onclick="window.location.href = '1384896?op=preview&back_url=1366648'; return false">7-14-FUS_light_ind_2 (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384936/7-14-NICD_light%20induced_2%20(1).jpg" onclick="window.location.href = '1384936?op=preview&back_url=1366648'; return false">7-14-NICD_light induced_2 (1).jpg</a></td> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384856/7-14-SPD5_light_ind-02_2%20(1).jpg" onclick="window.location.href = '1384856?op=preview&back_url=1366648'; return false">7-14-SPD5_light_ind-02_2 (1).jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1385131/YFP_high-06_2.jpg" onclick="window.location.href = '1385131?op=preview&back_url=1366648'; return false">YFP_high-06_2.jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384901/7-14-FUS_light_ind_2%20(2).jpg" onclick="window.location.href = '1384901?op=preview&back_url=1366648'; return false">7-14-FUS_light_ind_2 (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384941/7-14-NICD_light%20induced_2%20(2).jpg" onclick="window.location.href = '1384941?op=preview&back_url=1366648'; return false">7-14-NICD_light induced_2 (2).jpg</a></td> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384861/7-14-SPD5_light_ind-02_2%20(2).jpg" onclick="window.location.href = '1384861?op=preview&back_url=1366648'; return false">7-14-SPD5_light_ind-02_2 (2).jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384906/7-14-FUS_uninduced-10%20(1).jpg" onclick="window.location.href = '1384906?op=preview&back_url=1366648'; return false">7-14-FUS_uninduced-10 (1).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384946/7-14-NICD_uninducefd-07_2%20(1).jpg" onclick="window.location.href = '1384946?op=preview&back_url=1366648'; return false">7-14-NICD_uninducefd-07_2 (1).jpg</a></td> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384866/7-14SPD5_unind-05_2%20(1).jpg" onclick="window.location.href = '1384866?op=preview&back_url=1366648'; return false">7-14SPD5_unind-05_2 (1).jpg</a></td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384911/7-14-FUS_uninduced-10%20(2).jpg" onclick="window.location.href = '1384911?op=preview&back_url=1366648'; return false">7-14-FUS_uninduced-10 (2).jpg</a></td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384951/7-14-NICD_uninducefd-07_2%20(2).jpg" onclick="window.location.href = '1384951?op=preview&back_url=1366648'; return false">7-14-NICD_uninducefd-07_2 (2).jpg</a></td> | ||
| + | <td> </td> | ||
| + | <td><a href="https://groups.uni-freiburg.de/bscw/bscw.cgi/d1384871/7-14SPD5_unind-05_2%20(2).jpg" onclick="window.location.href = '1384871?op=preview&back_url=1366648'; return false">7-14SPD5_unind-05_2 (2).jpg</a></td> | ||
| + | </tr> | ||
| + | </tbody> | ||
| + | </table> | ||
| + | |||
| + | <p> </p> | ||
| + | </body> | ||
| + | </html> </p> | ||
| + | |||
| + | |||
<p> Text </p> | <p> Text </p> | ||
</div> | </div> | ||
| Line 432: | Line 1,405: | ||
<div class="content"> | <div class="content"> | ||
<div class="wrapper"> | <div class="wrapper"> | ||
| − | |||
| − | |||
<h2>01.07.2019</h2> | <h2>01.07.2019</h2> | ||
| Line 661: | Line 1,632: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190702_pcr_inteins.png" alt="PCR Gelelctrophoresis of Inteins"> |
</div> | </div> | ||
| Line 1,160: | Line 2,131: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190709 backbone n int.png" |
alt="Gelelekt. PCR NI BB"> | alt="Gelelekt. PCR NI BB"> | ||
| Line 1,180: | Line 2,151: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190710 backbone c int.png"> |
</div> | </div> | ||
| Line 1,238: | Line 2,209: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190711 gibson ints + bb.png"> |
</div> | </div> | ||
| Line 1,576: | Line 2,547: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190716 N-Int bsa1 mut dmso (E).png "> |
</div> | </div> | ||
| Line 1,785: | Line 2,756: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190729 C-Int bsaI mut.png "> |
</div> | </div> | ||
| Line 1,810: | Line 2,781: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190730 PCR Products of SUMO1 and TRX.png "> |
</div> | </div> | ||
| Line 2,544: | Line 3,515: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190814 PCR of Secretion Insertion Fragments.png "> |
</div> | </div> | ||
| Line 2,679: | Line 3,650: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190821-Western Blot stained against TRX.png "> |
</div> | </div> | ||
| Line 2,719: | Line 3,690: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190823 comassie stain of NI SUMO and CI TRX.png "> |
</div> | </div> | ||
| Line 2,798: | Line 3,769: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190826 vers sumo expr.png "> |
</div> | </div> | ||
| Line 2,911: | Line 3,882: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190829 SUMO1 Western Blot Inclusion bodies.PNG "> |
</div> | </div> | ||
| Line 2,990: | Line 3,961: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="200" src=" | + | <img width="200" src="../../imgs/Intein_Project/190831first mbp PCR.png "> |
</div> | </div> | ||
| Line 3,065: | Line 4,036: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="800" src=" | + | <img width="800" src="../../imgs/Intein_Project/190902 sfGFP_CI_TRX Sequencing.PNG"> |
</div> | </div> | ||
| Line 3,244: | Line 4,215: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190908 1 fluorescence medium.png "> |
</div> | </div> | ||
| Line 3,252: | Line 4,223: | ||
<div class="centerimgs"> | <div class="centerimgs"> | ||
| − | <img width="400" src=" | + | <img width="400" src="../../imgs/Intein_Project/190908 2 fluorescence pellet.png "> |
</div> | </div> | ||
| Line 3,259: | Line 4,230: | ||
<p> </p> | <p> </p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
<p> </p> | <p> </p> | ||
| Line 3,283: | Line 4,251: | ||
<p>- blotted on PVDF membrane (30 min, 1 A), blocked with 5% BSA (2 h), washed 1x with TBST, added 1. antibody (Mouse anti TRX 1:1000) in 10 mL TBST with 5% BSA (1 h), washed 3x with TBST, added 2. antibody (Goat anti Mouse 488 1:2000) in 10 mL TBST with 5% BSA (1 h), washed 3x with TBST, took picture with Amersham™ Typhoon™Biomolecular Imager at 488 nm:</p> | <p>- blotted on PVDF membrane (30 min, 1 A), blocked with 5% BSA (2 h), washed 1x with TBST, added 1. antibody (Mouse anti TRX 1:1000) in 10 mL TBST with 5% BSA (1 h), washed 3x with TBST, added 2. antibody (Goat anti Mouse 488 1:2000) in 10 mL TBST with 5% BSA (1 h), washed 3x with TBST, took picture with Amersham™ Typhoon™Biomolecular Imager at 488 nm:</p> | ||
| − | + | <p>BBBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDD</p> | |
| − | + | ||
| − | + | ||
| − | </ | + | |
| − | + | ||
<p>- sfGFP-CI-TRX should be seen at 44 kDa and all fluorescent samples show the right band, indicating that if sfGFP gets secreted it can carry a protein fused to it</p> | <p>- sfGFP-CI-TRX should be seen at 44 kDa and all fluorescent samples show the right band, indicating that if sfGFP gets secreted it can carry a protein fused to it</p> | ||
| Line 3,302: | Line 4,266: | ||
<p>- Gelelctrophoresis:</p> | <p>- Gelelctrophoresis:</p> | ||
| − | < | + | <p>BBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<p>- lane 5 (62.6°C with GC-Enahncer), 6 (64.1°C with GC-Enhancer), 10 (62.6°C with 5% DMSO) and 11 (64.1°C with 5% DMSO) showed bands of the right size (5.7 kb)</p> | <p>- lane 5 (62.6°C with GC-Enahncer), 6 (64.1°C with GC-Enhancer), 10 (62.6°C with 5% DMSO) and 11 (64.1°C with 5% DMSO) showed bands of the right size (5.7 kb)</p> | ||
| Line 3,327: | Line 4,287: | ||
<p>- Gelelectrophoresis:</p> | <p>- Gelelectrophoresis:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBbbIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
<p>- PCR product has the right size (1.2 kb), did a PCR purification of the rest of the sample</p> | <p>- PCR product has the right size (1.2 kb), did a PCR purification of the rest of the sample</p> | ||
| Line 3,364: | Line 4,321: | ||
<p>- results from the sfGFP secretion experiment:</p> | <p>- results from the sfGFP secretion experiment:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDd</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| + | <p>BBBBBBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDD</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<p>- fluorescence in the medium already rises at 8 h after induction, strongly indicating secretion of sfGFP-CI-TRX</p> | <p>- fluorescence in the medium already rises at 8 h after induction, strongly indicating secretion of sfGFP-CI-TRX</p> | ||
| Line 3,402: | Line 4,347: | ||
<p>- results:</p> | <p>- results:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDdd</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| + | <p>BBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDd</p> | ||
| + | <p>BBBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDD</p> | ||
<p> </p> | <p> </p> | ||
| Line 3,441: | Line 4,373: | ||
<p>- results of fluorescence measurement:</p> | <p>- results of fluorescence measurement:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDd</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| + | <p>BBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDDDDDDDD</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<p> </p> | <p> </p> | ||
| Line 3,497: | Line 4,419: | ||
<p>- took picture with Amersham™ Typhoon™Biomolecular Imager at 488 nm:</p> | <p>- took picture with Amersham™ Typhoon™Biomolecular Imager at 488 nm:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<p>- the Western Blot clearly shows a big difference in the amount of protein that were in the medium, at each timepoint the sfGFP-CI-TRX bands (44 kDa) are way more intense than the CI-TRX bands (17kDa), indicating that the fusionprotein enters the medium mainly via secretion instead of lysis</p> | <p>- the Western Blot clearly shows a big difference in the amount of protein that were in the medium, at each timepoint the sfGFP-CI-TRX bands (44 kDa) are way more intense than the CI-TRX bands (17kDa), indicating that the fusionprotein enters the medium mainly via secretion instead of lysis</p> | ||
| Line 3,624: | Line 4,542: | ||
<p>- Gelelectrophoresis:</p> | <p>- Gelelectrophoresis:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDD</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
<p>- the left band, with GC-Enhancer, has the perfect size (5.6 kbp) and the rest of sample was purified by PCR purification</p> | <p>- the left band, with GC-Enhancer, has the perfect size (5.6 kbp) and the rest of sample was purified by PCR purification</p> | ||
| Line 3,952: | Line 4,866: | ||
<p>Stain the gel with Instant Blue for 30 minutes.</p> | <p>Stain the gel with Instant Blue for 30 minutes.</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDd</p> |
| − | + | ||
| − | + | ||
| − | + | ||
| + | <p><u>Splicing test</u></p> | ||
<p>Load a 12% acrylamide gel with 18 µL of each sample:</p> | <p>Load a 12% acrylamide gel with 18 µL of each sample:</p> | ||
| Line 3,993: | Line 4,905: | ||
<p>Visualize with Typhoon laser scanner at 488 nm:</p> | <p>Visualize with Typhoon laser scanner at 488 nm:</p> | ||
| − | < | + | <p>BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLLLDDDDDDDDDDDDDDDDDDDDDDDDDd</p> |
| − | + | ||
| − | + | ||
| − | + | ||
<p> </p> | <p> </p> | ||
| Line 4,178: | Line 5,087: | ||
<tr><td> </td><td></td></tr> | <tr><td> </td><td></td></tr> | ||
</tbody></table> | </tbody></table> | ||
| − | |||
</div> | </div> | ||
| Line 4,184: | Line 5,092: | ||
</div> | </div> | ||
</div> | </div> | ||
| − | |||
| − | |||
| − | |||
<div class="sponsors"> | <div class="sponsors"> | ||
<div class="sponsorsrow"> | <div class="sponsorsrow"> | ||
Revision as of 16:47, 28 November 2019
Short description of what has been done
04.06.19
- Made 1:10 dilutions of all primers
| Primers | Cloning of Droplet forming proteins | TM °C | Ta °C | ||
| Name | Tube name | Sequence (overlap/spacer/ANNEAL) | Use | ||
| pBAD33_fwd | pBAD33_sfGFP_gibson_f | gctctacaaaTAAATCGATCGCGTTAGG | Gibson primer to join sfGFP and the start of the pBAD33 Backbone ( | 58.5 | 56.1 |
| pBAD33_rev | pBAD_FUS_gibson_rev | tagacgccatGCTAGCATTATACCTAGG | Gibson primer to join FUS and the end of pBAD33 Backbone | 55.1 | 56.1 |
| FUS_fwd | FUS_pBAD33_gibson_fw | taatgctagcATGGCGTCTAATGACTACACTCAGC | Gibson primer to join FUS and the end of pBAD33 Backbone (reverse) | 68.3 | 69.3 |
| FUS_rev | FUS_sfGFP_gibson_rev | cggatcctccGTATGGGCGCTCGCGACG | Gibson primer to join FUS and the sfGFP with linker(reverse) | 72.4 | 69.3 |
| linker_spGFP_fwd | gsGFP_pBAD33_gibson_f | gcgcccatacGGAGGATCCGGAGGATCC | Joins the start of sfGFP to the end of fus | 67.0 | 65.6 |
| linker_spGFP_rev | spGFP_pBAD33_gibson_r | gatcgatttaTTTGTAGAGCTCATCCATGCC | Gibson primer to join sfGFP and the start of the pBAD33 Backbone | 64.6 | 65.6 |
| SPD5 | |||||
| pBAD33_fwd | pBAD_SPD5_fwd | gctctacaaaTAAATCGATCGCGTTAGG | Gibson primer to join stGFP and the start of the pBAD33 Backbone | 58.5 | 56.1 |
| pBAD33_rev | pBAD33_SPD5_gibson_rev | tatcttccatGCTAGCATTATACCTAGG | Gibson primer to join stGFP and the start of the pBAD33 Backbone (reverse) | 55.1 | 56.1 |
| SPD5_1_fwd | SPD5_pBAD33_gibson_fwd | taatgctagcATGGAAGATAACTCTGTCCTTAATGAAG | Gibson primer to join SPD5_1 at the end of pBAD33 | 63.5 | 64.5 |
| SPD5_1_rev | SPD5_1_gibson_rev | gtgcaatagtGAAACGACGCGACGCTTC | Gibson primer to join SPD5_1 at the end of pBAD33 (reverse) | 67.2 | 64.5 |
| SPD5_2_fwd | SPD5_2_gibson_fw | gcgtcgtttcACTATTGCACCGGATGCTG | Gibson primer to join SPD5_2 at the end of SPD5_1 | 65.2 | 62.6 |
| SPD5_2_rev | SPD5_2_sfGFP_gibson_rev | cggatcctccCTTCTTGCGAATTTCCTTTACG | Gibson primer to join SPD5_2 at the end of SPD5_1 (reverse) | 61.6 | 62.6 |
| linker_spGFP_fwd | sfGFP_SPD5_2_gibson_fw | tcgcaagaagGGAGGATCCGGAGGATCC | Forward primer for sfGFP (at the end of SPD5) | 67.0 | 65.6 |
| linker_spGFP_rev | sfGFP_pBAD33_gibson_rev | gatcgatttaTTTGTAGAGCTCATCCATGCC | Reverse primer GFP at the start of pBAD | 64.6 | 65.6 |
| mCherry | |||||
| pBAD33_fwd | PBAD33_mCherry_gibson_fwd | cgagctgtacTAAATCGATCGCGTTAGG | Gibson primer to join mCHERRY and the start of the PBAD33 Backbone | 58.5 | 56.1 |
| pBAD33_rev | pBAD_EWSR1_gibson_rev | ttgaggccatGCTAGCATTATACCTAGG | Gibson primer to join mCHERRY and the start of the PBAD33 Backbone (reverse) | 55.1 | 56.1 |
| EWSR1_fwd | EWSR1_pBAD33_gibson_fwd | taatgctagcATGGCCTCAACTGACTACTC | Gibson primer to join EWSR1 and the end of the PBAD33 Backbone | 63.7 | 64.7 |
| EWSR1_rev | EWSR1_mCherry_gibson_rev | ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG | Gibson primer to join EWSR1 and the end of the PBAD33 Backbone (reverse) | 67.1 | 64.7 |
| GS_mCherry_fwd | mCherry_EWSR1_gibson_fwd | tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG | Gibson primer to join mCHERRY and the end of the EWSR1 | 68.8 | 66.9 |
| GS_mCherry_rev | mCherry_pBAD33_gibson_rev | gatcgatttaGTACAGCTCGTCCATGCC | Gibson primer to join mCHERRY and the end of the EWSR1 (reverse) | 65.9 | 66.9 |
| NiCD | |||||
| pBAD33_fwd | pBAD33_sfGFP_gibson_fwd | tgagctctacaaaTAAATCGATCGCGTTAGGC | Gibson primer to join sfGFP and the start of the PBAD33 Backbone | 57.1 | 60.4 |
| pBAD33_rev | pBAD33_NICD_gibson_rev | tgacgcattcatGCTAGCATTATACCTAGGACTG | Gibson primer to join sfGFP and the start of the PBAD33 Backbone (reverse) | 56.9 | 60.4 |
| NICD_fwd | NICD_pBAD33_gibson_fwd | gtataatgctagcATGAATGCGTCATGTGTAGGGG | Gibson primer to join NICD at the end of pBAD33 | 62.5 | 65.6 |
| NICD_rev | NICD_sfGFP_rev | ctcctttgctcatggatcctccggatcctccGACCAGATGGCCGCGCAG | Gibson primer to join NICD at the end of pBAD33 (reverse) | 65.7 | 65.6 |
| sfGFP_fwd | sfGFP_NICD_fwd | ggccatctggtcggaggatccggaggatccATGAGCAAAGGAGAAGAACTTTTC | Gibson primer to join sfGFP at the end of NCID | 59.1 | 60.8 |
| sfGFP_rev | sfGFP_pBAD33_rev | gcgatcgatttaTTTGTAGAGCTCATCCATGC | Gibson primer to join sfGFP at the end of NCID (reverse) | 57.3 |
60.8 |
Ordered gBlocks sequences:
EWSR1 (Ewing Sarcoma Breakpoint Region 1):
atggcctcaactgactactccacttactcgcaggcagcagcacagcaaggctacagcgcttatacagcccagccaacgcaaggatatgcccaaacaacgcaggcatacggtcagcagtcttacggcacttacggccagccaactgatgtctcttacactcaagctcagaccacagcgacttatggccagaccgcatatgccacctcttacggtcagcccccgaccgtggaaggaacgtcgactggctatacaactccaaccgctcctcaagcatacagccagccagtccaaggatatggaaccggtgcatacgatacaacaactgccacagtgacgactacacaggcttcttatgcagctcagagtgcatatgggactcaaccagcatacccggcatacggccagcagccagctgcaacagctccaacgcgtcctcaggatggcaacaagccaacagagacctcgcaaccccagtccagtacaggtggctacaatcagccctccttggggtatgggcagagtaactactcgtacccccaagtccccggttcttaccctatgcagcctgtcacggcgcccccgagctatccacctacctcctatagcagtacgcagcccacgtcatatgatcagtcctcatattcccagcaaaacacatatgggcaacctagcagttatggccagcagtcttcgtacgggcagcagtcatcgtatggacagcaacctccgacatcatatccaccacagaccggatcgtactctcaggcaccatcacaatattctcagcaatcatcgtcatacggtcagcagtcttcttttcgtcaggatcatccttcttcgatgggtgtatatggccaagaatcggggggattctctggaccgggtgagaaccgtagtatgtcaggcccagacaaccgtggccgtggtcgtggcggtttcgatcgtggtggcatgtcgcgcggtgggcgtggtgggggccgcgggggtatgggggcaggggagcgtggtgggtttaacaaaccaggtggaccgatggatgagggcccagatcttgacttgggtccaccagtcgatccggatgaggattcagacaatagtgcaatttacgtgcaggggttaaatgactccgtgacgctggatgatctggccgatttcttcaaacaatgcggcgtagtaaaaatgaataaacgcacaggtcaacccatgattcatatctacttggacaaagagactggcaaaccaaaaggagacgctacggtatcatatgaggaccctccaacagctaaagccgctgttgagtggtttgatggaaaagacttccagggaagcaaattaaaggtatcattagcgcgtaaaaaaccacctatgaactcaatgcgcggcggactgccgccccgcgaaggtcgtggtatgccaccgccacttcgtggaggacctggaggtccaggaggtccaggtggtcctatgggacgaatgggaggtcgtggcggcgaccgcgggggttttcctccgcgcgggccccgtggtagtcgtggtaacccttcagggggcggcaacgtgcaacatcgcgcaggcgattggcagtgtccaaacccgggttgcggtaatcagaacttcgcgtggcgtacagaatgtaatcagtgcaaagcgccaaaaccagaaggttttcttccacccccgtttccacctccaggcggagaccgtggccgtggagggccgggtggtatgcgcggcggacgcggaggtcttatggatcgcggtggtccgggcgggatgtttcgtgggggtcgcggcggggatcgtggaggtttccgcggaggtcgcggaatggatcgtggcggattcggaggaggacgtcgtggtggtccaggggggcctcctggtcctctgatggagcagatgggagggcgccgcggtggtcgtggcgggccaggcaagatggataaaggtgagcaccgtcaagagcgccgtgatcgtccctatggaggatccggaggatcc
FUS:
atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac
NICD (Nephrin Intracellular Domain)
atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc
SPD5:
atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag
| Created Plasmids in first cloning phase | |||||
| Backbone | Insert | Insert | Promoter | Resistance | |
| P1 | pBAD33 | EWSR1 | mCherry | J23119 | Chloramphenicol |
| P2 | pBAD33 | FUS | sfGFP | J23119 | Chloramphenicol |
| P3 | pBAD33 | SPD5 | sfGFP | J23119 | Chloramphenicol |
| P4 | pBAD33 | NICD | sfGFP | J23119 | Chloramphenicol |








"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>
<a target="_blank" rel="noopener noreferrer" href="
"/></a>