Difference between revisions of "Team:Freiburg/Labbook/In Vivo"

04.06.19

- Made 1:10 dilutions of all primers 

Primers		Cloning of Droplet forming proteins		TM °C	Ta °C
Name	Tube name	Sequence (overlap/spacer/ANNEAL)	Use
pBAD33_fwd	pBAD33_sfGFP_gibson_f	gctctacaaaTAAATCGATCGCGTTAGG	Gibson primer to join sfGFP and the start of the pBAD33 Backbone (	58.5	56.1
pBAD33_rev	pBAD_FUS_gibson_rev	tagacgccatGCTAGCATTATACCTAGG	Gibson primer to join FUS and the end of pBAD33 Backbone	55.1	56.1
FUS_fwd	FUS_pBAD33_gibson_fw	taatgctagcATGGCGTCTAATGACTACACTCAGC	Gibson primer to join FUS and the end of pBAD33 Backbone (reverse)	68.3	69.3
FUS_rev	FUS_sfGFP_gibson_rev	cggatcctccGTATGGGCGCTCGCGACG	Gibson primer to join FUS and the sfGFP with linker(reverse)	72.4	69.3
linker_spGFP_fwd	gsGFP_pBAD33_gibson_f	gcgcccatacGGAGGATCCGGAGGATCC	Joins the start of sfGFP to the end of fus	67.0	65.6
linker_spGFP_rev	spGFP_pBAD33_gibson_r	gatcgatttaTTTGTAGAGCTCATCCATGCC	Gibson primer to join sfGFP and the start of the pBAD33 Backbone	64.6	65.6
SPD5
pBAD33_fwd	pBAD_SPD5_fwd	gctctacaaaTAAATCGATCGCGTTAGG	Gibson primer to join stGFP and the start of the pBAD33 Backbone	58.5	56.1
pBAD33_rev	pBAD33_SPD5_gibson_rev	tatcttccatGCTAGCATTATACCTAGG	Gibson primer to join stGFP and the start of the pBAD33 Backbone (reverse)	55.1	56.1
SPD5_1_fwd	SPD5_pBAD33_gibson_fwd	taatgctagcATGGAAGATAACTCTGTCCTTAATGAAG	Gibson primer to join SPD5_1 at the end of pBAD33	63.5	64.5
SPD5_1_rev	SPD5_1_gibson_rev	gtgcaatagtGAAACGACGCGACGCTTC	Gibson primer to join SPD5_1 at the end of pBAD33 (reverse)	67.2	64.5
SPD5_2_fwd	SPD5_2_gibson_fw	gcgtcgtttcACTATTGCACCGGATGCTG	Gibson primer to join SPD5_2 at the end of SPD5_1	65.2	62.6
SPD5_2_rev	SPD5_2_sfGFP_gibson_rev	cggatcctccCTTCTTGCGAATTTCCTTTACG	Gibson primer to join SPD5_2 at the end of SPD5_1 (reverse)	61.6	62.6
linker_spGFP_fwd	sfGFP_SPD5_2_gibson_fw	tcgcaagaagGGAGGATCCGGAGGATCC	Forward primer for sfGFP (at the end of SPD5)	67.0	65.6
linker_spGFP_rev	sfGFP_pBAD33_gibson_rev	gatcgatttaTTTGTAGAGCTCATCCATGCC	Reverse primer GFP at the start of pBAD	64.6	65.6
mCherry
pBAD33_fwd	PBAD33_mCherry_gibson_fwd	cgagctgtacTAAATCGATCGCGTTAGG	Gibson primer to join mCHERRY and the start of the PBAD33 Backbone	58.5	56.1
pBAD33_rev	pBAD_EWSR1_gibson_rev	ttgaggccatGCTAGCATTATACCTAGG	Gibson primer to join mCHERRY and the start of the PBAD33 Backbone (reverse)	55.1	56.1
EWSR1_fwd	EWSR1_pBAD33_gibson_fwd	taatgctagcATGGCCTCAACTGACTACTC	Gibson primer to join EWSR1 and the end of the PBAD33 Backbone	63.7	64.7
EWSR1_rev	EWSR1_mCherry_gibson_rev	ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG	Gibson primer to join EWSR1 and the end of the PBAD33 Backbone (reverse)	67.1	64.7
GS_mCherry_fwd	mCherry_EWSR1_gibson_fwd	tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG	Gibson primer to join mCHERRY and the end of the EWSR1	68.8	66.9
GS_mCherry_rev	mCherry_pBAD33_gibson_rev	gatcgatttaGTACAGCTCGTCCATGCC	Gibson primer to join mCHERRY and the end of the EWSR1 (reverse)	65.9	66.9
NiCD
pBAD33_fwd	pBAD33_sfGFP_gibson_fwd	tgagctctacaaaTAAATCGATCGCGTTAGGC	Gibson primer to join sfGFP and the start of the PBAD33 Backbone	57.1	60.4
pBAD33_rev	pBAD33_NICD_gibson_rev	tgacgcattcatGCTAGCATTATACCTAGGACTG	Gibson primer to join sfGFP and the start of the PBAD33 Backbone (reverse)	56.9	60.4
NICD_fwd	NICD_pBAD33_gibson_fwd	gtataatgctagcATGAATGCGTCATGTGTAGGGG	Gibson primer to join NICD at the end of pBAD33	62.5	65.6
NICD_rev	NICD_sfGFP_rev	ctcctttgctcatggatcctccggatcctccGACCAGATGGCCGCGCAG	Gibson primer to join NICD at the end of pBAD33 (reverse)	65.7	65.6
sfGFP_fwd	sfGFP_NICD_fwd	ggccatctggtcggaggatccggaggatccATGAGCAAAGGAGAAGAACTTTTC	Gibson primer to join sfGFP at the end of NCID	59.1	60.8
sfGFP_rev	sfGFP_pBAD33_rev	gcgatcgatttaTTTGTAGAGCTCATCCATGC	Gibson primer to join sfGFP at the end of NCID (reverse)	57.3	60.8

 

Ordered gBlocks sequences:

EWSR1 (Ewing Sarcoma Breakpoint Region 1):

atggcctcaactgactactccacttactcgcaggcagcagcacagcaaggctacagcgcttatacagcccagccaacgcaaggatatgcccaaacaacgcaggcatacggtcagcagtcttacggcacttacggccagccaactgatgtctcttacactcaagctcagaccacagcgacttatggccagaccgcatatgccacctcttacggtcagcccccgaccgtggaaggaacgtcgactggctatacaactccaaccgctcctcaagcatacagccagccagtccaaggatatggaaccggtgcatacgatacaacaactgccacagtgacgactacacaggcttcttatgcagctcagagtgcatatgggactcaaccagcatacccggcatacggccagcagccagctgcaacagctccaacgcgtcctcaggatggcaacaagccaacagagacctcgcaaccccagtccagtacaggtggctacaatcagccctccttggggtatgggcagagtaactactcgtacccccaagtccccggttcttaccctatgcagcctgtcacggcgcccccgagctatccacctacctcctatagcagtacgcagcccacgtcatatgatcagtcctcatattcccagcaaaacacatatgggcaacctagcagttatggccagcagtcttcgtacgggcagcagtcatcgtatggacagcaacctccgacatcatatccaccacagaccggatcgtactctcaggcaccatcacaatattctcagcaatcatcgtcatacggtcagcagtcttcttttcgtcaggatcatccttcttcgatgggtgtatatggccaagaatcggggggattctctggaccgggtgagaaccgtagtatgtcaggcccagacaaccgtggccgtggtcgtggcggtttcgatcgtggtggcatgtcgcgcggtgggcgtggtgggggccgcgggggtatgggggcaggggagcgtggtgggtttaacaaaccaggtggaccgatggatgagggcccagatcttgacttgggtccaccagtcgatccggatgaggattcagacaatagtgcaatttacgtgcaggggttaaatgactccgtgacgctggatgatctggccgatttcttcaaacaatgcggcgtagtaaaaatgaataaacgcacaggtcaacccatgattcatatctacttggacaaagagactggcaaaccaaaaggagacgctacggtatcatatgaggaccctccaacagctaaagccgctgttgagtggtttgatggaaaagacttccagggaagcaaattaaaggtatcattagcgcgtaaaaaaccacctatgaactcaatgcgcggcggactgccgccccgcgaaggtcgtggtatgccaccgccacttcgtggaggacctggaggtccaggaggtccaggtggtcctatgggacgaatgggaggtcgtggcggcgaccgcgggggttttcctccgcgcgggccccgtggtagtcgtggtaacccttcagggggcggcaacgtgcaacatcgcgcaggcgattggcagtgtccaaacccgggttgcggtaatcagaacttcgcgtggcgtacagaatgtaatcagtgcaaagcgccaaaaccagaaggttttcttccacccccgtttccacctccaggcggagaccgtggccgtggagggccgggtggtatgcgcggcggacgcggaggtcttatggatcgcggtggtccgggcgggatgtttcgtgggggtcgcggcggggatcgtggaggtttccgcggaggtcgcggaatggatcgtggcggattcggaggaggacgtcgtggtggtccaggggggcctcctggtcctctgatggagcagatgggagggcgccgcggtggtcgtggcgggccaggcaagatggataaaggtgagcaccgtcaagagcgccgtgatcgtccctatggaggatccggaggatcc

FUS:

atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac

NICD (Nephrin Intracellular Domain)

atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc

SPD5:

atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag

Created Plasmids in first cloning phase
	Backbone	Insert	Insert	Promoter	Resistance
P1	pBAD33	EWSR1	mCherry	J23119	Chloramphenicol
P2	pBAD33	FUS	sfGFP	J23119	Chloramphenicol
P3	pBAD33	SPD5	sfGFP	J23119	Chloramphenicol
P4	pBAD33	NICD	sfGFP	J23119	Chloramphenicol

 

 

Subsection Title #2

Text

Subsection Title

Text

Subsection Title #2

Text

01.07.2019

- PCR of the N-Intein (Npu DnaE, BBa_K1362100)

- Master Mix (50µL):

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19nifwd 10µM	2.5 µL	0.5 µM
Primer: oIG19nirev 10 µM	2.5 µL	0.5 µM
Template DNA 200-300 pg/µL	3 µL	600-900 pg
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	30.5 µL	-

- PCR Programm:

Step	Temp.	Time
Initial Denaturation	98°C	3 min
Denaturation         Annealing         30x Extension	98°C 54°C 72°C	10 sec 25 sec 45 sec
Final Extension	72°C	2 min
Hold	4°C	-

 

---

 

02.07.2019

- PCR of the C-Intein (Npu DnaE, BBa_K136201)

Master Mix (50µL):

reagents	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19cifwd 10µM	2.5 µL	0.5 µM
Primer: oIG19cirev 10 µM	2.5 µL	0.5 µM
Template DNA 200-300 pg/µL	3 µL	600-900 pg
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	30.5 µL	-

PCR Programm:

Step	Temp.	Time
Initial Denaturation	98°C	3 min
Denaturation         Annealing         30x Extension	98°C 56°C 72°C	10 sec 25 sec 42 sec
Final Extension	72°C	2 min
Hold	4°C	-

- Gelelectrophoresis (1% Agarose, 100 V, 50 min, with Midori Green (3 µL/100 mL):

H2O C-Int

H2O N-Int

...

1 kb ladder

...

C-Int

C-Int

C-Int

N-Int

N-Int

- Gelextraction with NucleoSpin® Gel and PCR Clean-up from Machery-Nagel following the protocol (page 19) at:
https://www.mn-net.com/Portals/8/attachments/Redakteure_Bio/Protocols/DNA%20clean-up/UM_PCRcleanup_Gelex_NSGelPCR.pdf

 

---

 

04.07.2019

- PCR of pET302 for the C-Intein

Master Mix (50 µL):

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19bbcifwd 10µM	2.5 µL	0.5 µM
Primer: oIG19bbcirev 10 µM	2.5 µL	0.5 µM
Template DNA 86 ng/µL	1 µL	86 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	32.5 µL	-

 PCR Programm:

Step	Temp.	Time
Initial Denaturation	98°C	3 min
Denaturation         Annealing         30x Extension	98°C 64°C 72°C	10 sec 30 sec 3 min
Final Extension	72°C	3 min
Hold	4°C	-

 

---

 

05.07.2019

- PCR of pET302 for N-Intein

Master Mix (50 µL):

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19bbnifwd 10µM	2.5 µL	0.5 µM
Primer: oIG19bbnirev 10 µM	2.5 µL	0.5 µM
Template DNA 86 ng/µL	1 µL	86 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	32.5 µL	-

 PCR Programm:

Step	Temp.	Time
Initial Denaturation	98°C	3 min
Denaturation         Annealing         30x Extension	98°C 64°C 72°C	10 sec 30 sec 3 min
Final Extension	72°C	3 min
Hold	4°C	-

- Gelelektrophoresis (100 V, 90 min, 1% Agarose, Midori Green 3 µL/100 mL) showed no bands

- troubleshooting showed that i used too much DNA

- Did a gradient PCR for C-Int bb:

Master Mix 300 µL:

reagent	amount	concentration
5X Q5 Reaction Buffer	60 µL	1X
10 mM dNTPs	6 µL	200 µM
Primer: oIG19bbcifwd 10µM	15 µL	0.5 µM
Primer: oIG19bbcirev 10 µM	15 µL	0.5 µM
Template DNA 9.8 ng/µL	1 µL	1,96 ng
Q5 High-Fidelity DNA Polymerase	6 µL	0.02 U/µL
Nuclease-Free Water	200 µL	-

- took 50 µL of the mastermix away before adding the DNA to have a H2O control, put the rest in 5 tubes, annealed at the following temperatures:

tube 1	tube 2	tube 3	tube4	tube 5	H2O tube
55,1°C	56,8°C	59,5°C	61°C	63,7°C	63,7°C

PCR Programm:

Step	Temp.	Time
Initial Denaturation	98°C	3 min
Denaturation         Annealing         30x Extension	98°C -  °C 72°C	10 sec 30 sec 4,5 min
Final Extension	72°C	4.5 min
Hold	4°C	-

 

---

 

06.07.2019

- repeated the gradient-PCR with the pET302 for the N-Intein

 

---

 

08.07.2019

- Gelelektrophoresis (100V, 1% Agarose, 75 min) showed no bands

- found out that the touch-down function was activated

- did a Gradient PCR for the N-Intein Backbone:

Master Mix 350µL:

reagent	amount	concentration
5X Q5 Reaction Buffer	70 µL	1X
10 mM dNTPs	7 µL	200 µM
Primer: oIG19bbnifwd 10µM	17.5 µL	0.5 µM
Primer: oIG19bbnirev 10 µM	17.5 µL	0.5 µM
Template DNA 9.8 ng/µL (added after taking 50µL of the MM for H2O control)	0.6 µL	1.96 ng
Q5 High-Fidelity DNA Polymerase	3.5 µL	0.02 U/µL
Nuclease-Free Water	233.9 µL	-

- took 50 µL of the mastermix away before adding the DNA to have a H2O control, put the rest in 6 tubes, annealed at the following temperatures:

tube 1	tube 2	tube 3	tube4	tube 5	tube 6	H2O tube
49,2°C	51,5°C	55,2°C	57,3°C	61,1°C	64,1°C	64,1°C

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         30x Extension	96°C -  °C 72°C	30 sec 30 sec 4.5 min
Final Extension	72°C	10 min
Hold	4°C	-

 

---

 

09.07.2019

- Gelelektrophoresis of the N-Int. BB PCR (100V, 1% Agarose, 75 min, Midori Green (3 µL/100 mL)) showed:

-did a PCR extraction of the tubes of the bands 2,4,5 after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/General_Information/1/high-pure-pcr-product-purification-kit.pdf (page 7)

- repeated the PCR with the same conditions for the C-Intein BB

 

---

 

10.07.2019

- Gelelektrophoresis of the C-Int. BB PCR (100V, 1% Agarose, 75 min, Midori Green (3 µL/100 mL)) showed:

- did a PCR extraction of the tubes after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/General_Information/1/high-pure-pcr-product-purification-kit.pdf (page 7)

- did 2 Gibson assemblys 1 h, 50°C (protocol: https://international.neb.com/protocols/2014/11/26/nebuilder-hifi-dna-assembly-reaction-protocol) with the following amounts of DNA:

N-Intein (1464bp)	BB for N-Intein (5683bp)	C-Intein (1259bp)	BB for C-Intein (5682bp)
38.64ng	50ng	33.24ng	50ng

- did a transformation with competent TOP10 cells following the protocol of: https://international.neb.com/protocols/0001/01/01/high-efficiency-transformation-protocol-c2987

- platet the cells on Agar plates with Ampicillin and let grow overnight at 37°C

 

---

 

11.07.2019

- no colonies on the plates

- did a gelelectrophoresis (1% Agarose, 100 V, 75 min, Midori Green (3 µL/100 mL)) with the following DNA Products:

ladder

N-Int

BB for N-Int

Gibson BB+N-Int (40ng)

C-Int

BB for C-Int

Gibson BB+C-Int (40ng)

ladder

 - had to do a post-staining with Gel-Red (30 min):

- bands of coiled plasmids can be seen in the top area

- did another transformation with NEB 5-alpha competent cells following this protocol: https://international.neb.com/protocols/0001/01/01/high-efficiency-transformation-protocol-c2987

- plated on Agar plates with Ampicillin and let grow overnight at 37°C

 

---

 

12.07.2019

- colonies did grow overnight and did show red fluorescence as the should with a functioning biobrick inserted into the plasmid

- picked colonies and let grow overnight at 37°C in 2ml of LB-medium with Ampicillin (100 µg/ml) each

 

---

 

13.07.2019

- cultures did grow well,  a miniprep was performed following this protocol: https://files.zymoresearch.com/protocols/_d4208t_d4209_d4210_d4211_d4212_zymopure_plasmid_miniprep.pdf (page 4 + 6)

- with the harvested plasmids a PCR was performed to insert a point mutation to delete a BsaI restriction site:

PCR Programm: BsaI point mutation :

Master Mix 1 (50µL) each for N-/C-Intein:

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19bbBsaI mut fwd 10µM	2.5 µL	0.5 µM
Primer: oIG19bbBsaI mut rev 10 µM	2.5 µL	0.5 µM
Template DNA 1.2 ng/µL	1 µL	1.2 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	30.5 µL	-
DMSO	2 µL	4%

Master Mix 2 (50µL) each for N-/C-Intein:

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19bbBsaI mut fwd 10µM	2.5 µL	0.5 µM
Primer: oIG19bbBsaI mut rev 10 µM	2.5 µL	0.5 µM
Template DNA 1.2 ng/µL	1 µL	1.2 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	32.5 µL	-

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1.5 min
Denaturation         Annealing         30x Extension	96°C 72°C 72°C	35 sec 30 sec 5 min 45 sec
Final Extension	72°C	10 min
Hold	4°C	-

 

---

 

15.07.2019

- did a gelelectrophoresis (1% Agarose, 100 V, 80 min, Midori Green (3 µL/100 mL)), no plasmid bands

- did a gradient PCR with the N-Intein + BB to get out the BsaI restriction site:

Master Mix (150µL for 10 tubes):

reagent	amount	concentration
5X Q5 Reaction Buffer	30 µL	1X
10 mM dNTPs	3 µL	200 µM
Primer: oIG19bbBsaI mut fwd 10µM	7.5 µL	0.5 µM
Primer: oIG19bbBsaI mut rev 10 µM	7.5 µL	0.5 µM
Template DNA 1.2 ng/µL	3 µL	1.2 ng/50 µL
Q5 High-Fidelity DNA Polymerase	1.5 µL	0.02 U/µL
Nuclease-Free Water	97.5 µL	-

Annealing Temperatures: 

tube	1	2	3	4	5	6	7	8	9	H2O
temp.	55°C	56.2°C	57.5°C	59.4°C	62°C	65°C	67.6°C	69.5°C	71.6°C	71.6°C

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1.5 min
Denaturation         Annealing         30x Extension	96°C - °C 72°C	35 sec 30 sec 5 min 45 sec
Final Extension	72°C	10 min
Hold	4°C	-

- Gelelectrophoresis showed no bands

 

---

 

16.07.2019

- Did a PCR with the N-Int. with 3, 5 and 10% DMSO whith the annealing temperatures = Tm - 0.6°C x 1% DMSO

- Gelelectrophoresis showed a band of the right size (on the right, same size as +ctrl on the left)

 

---

 

16.07.2019

- Did a DpnI Digestion of the N-Int 10% DMSO tube (0.5 µL DpnI, 1 h, 37°C)

- Did a PCR-Extraction after the protocol of: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Roche/Bulletin/1/hppcrpkrobul.pdf (page 7)

- Did 2 PCRs of the C-Intein, one with BsaI mut fwd and a rev Primer in the Amp. Resistance, and one with BsaI mut rev and a fwd primer in the Amp. Res.

 

---

 

17.07.2019

- Gelelctrophoresis showed bands of the right size for the two PCRs with the Primers inside of the Amp. Resistance, both constructs were isolated with Gel-Extraction and a Gibson Asembly was performed

- Did a Transformation with the N-Int construct (out of the 10% DMSO tube) and the C-Int construct (out of the Gibbson assembly) into NEB Alpha-5 competent cells

- plated on Agar plates with Amp and let incubate overnight at 37°C

 

---

 

18.07.2019

- colonies did grow for both constructs! picked 3 colonies each and put into 2 mL of LB medium with Amp, let grow overnight

 

---

 

19.07.2019

- did a mini-prep of each culture with Zymo-Miniprep kit, send the isolated plasmids to sequencing

 

---

 

24.07.2019

- Sequencing uncomplete because of wrong primers but point mutations were inserted succesful in both constructs

- repeated sequencing with other primers

 

---

 

25.07.2019

- Sequencing showed that the N-Int has no unwanted pointmutations and the insert is fully inserte

- but the C-Intein construct is not fully inserted, parts of the insert are missing, will repeat the point mutation PCR with 10% DMSO instead of the Gibson approach

 

---

 

26.07.2019

- Gelelectrophoresis showed no bands

- did a PCR (following https://international.neb.com/protocols/2013/12/13/pcr-using-q5-high-fidelity-dna-polymerase-m0491) with the C-Intein + BB with the fwd and rev Primer in seperate tubes (16 cycles), then  mixed together and did 14 cycles

 

---

 

27.07.2019

- Gelelectrophoresis showed a band that was approx. 500bp to small

- looking closer at the sequence showed ~75% GC content at one region

 

---

 

28.07.2019

- repeated the PCR of C-Int + BB with seperated Primer but added GC-Enhancer

Master Mix (50µL each)

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19BB bsaI mut fwd / rev	2.5 µL	0.5 µM
Template DNA (C-Int + BB) 1 ng/µL	1 µL	1 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	25 µL	-
High GC-Enhancer	10 µL	1X

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         16x, then mix both tubes, 14x Extension	96°C 70°C 72°C	30 sec 30 sec 5 min
Final Extension	72°C	10 min
Hold	4°C	-

 

---

 

29.07.2019

- Gelelctrophoresis showed band of the right size (ladder, +ctrl, tube 1. tube 2, too short band without GC-Enhancer):

- did a PCR-Purification of the remaining samples

- did transformation of the mutated C-Int + BB construct with competent NEB 5-alpha cells, platet on Agarplates with Amp, incubated overnight

- picked colonies with the SUMO1-Plasmid (obtained from BIOSS Toolbox, University Freiburg) and cultured them in 3 mL LB-Medium with Amp. overnight

 

---

 

30.07.2019

- Did a Mini Prep of the SUMO1 cultures

- Did a PCR with TrxA (obtained from Di Ventura Lab, University Freiburg)(Primers: IG19BB TrxA fwd/rev) and with SUMO1 (Primers: IG19BB SUMO1 fwd/rev) , introduced the overhangs from RFC105 for the Golden Gate Assembly

- Gelelctrophoresis (100bp ladder, SUMO1, TrxA, 1kb ladder):

- both PCR products had the right size: PCR purification

- Picked colonies with the mutated C-Int + BB construct (from 29.07) and cultured them in 2 mL LB-Medium with Amp overnight

 

---

 

31.07.2019

- Did a Mini Prep of the cultures with the mutated C-Int + BB construct

- Send them to Sequencing

 

---

 

01.08.2019

- Sequencing succesful

- Inserted SUMO1 into N-Int + BB mut and TrxA into the C-Int. + BB mut constructs, both with Golden Gate Assembly:

Master Mix (each): 3:1 (Insert:Backbone(150ng)), 1.5 µL T4 DNA Ligase Buffer, 9 µL dH20 (filled up to 15 µL), 1µL BsaI, 1µL T4 DNA Ligase

Cycler Program:

Step	Temp.	Time
Restriction                        x25 Ligation	37°C   16°C	3 min   4 min
Final Restriction	50°C	5 min
Denaturation	80°C	5 min
Hold	4°C	-

- Did a Transformation with NEB 5-Alpha comp. cells with 2 or 4 µL of the Golden Gate product and plated the cells on Agar plates with Amp., incubated at 37°C o/n

 

---

 

02.08.2019

- colonies did grow! picked 2 of each construct and cultured in 2 mL LB-Medium with Amp.

- after 7 hours did a Mini Prep and sent all DNA to Sequencing

- reincubated the remaining cells in the tube in 4mL LB-Medium with Amp.

 

---

 

04.08.2019

- Did a Miniprep of the NI-SUMO1 and CI-Trx cultures, same cultures as sent to sequencing, did this to have enough DNA

 

---

 

05.08.2019

- Sequencing showed that Golden Gate Asembly was performed succesful

 

---

 

11.08.2019

- Cultured bacteria with NI-SUMO and CI-TRX in 2 mL LB-medium + Amp at 37°C for 6 hours

- measured OD and put the amount of bacteria into 4 mL of LB -medium + Amp to have OD 0.1, incubated 1 hour at 37°C

- after 1 h added IPTG with 1mM end concentration, incubated 2 more hours then pelletized and stored pellets o/n at -80°C

 

---

 

12.08.2019

- resuspended the pellets in 250 µL Promega FastBreak Lysis Buffer, added PMSF (1mM), sonicated the cells (3 x 6 cycles of 1 min, max volume)

- centrifuged the lysate 15 min at max speed at 4°C, took the supernatant and stored on ice

- prepared 4 tubes:

tube	1	2	3	4
ingredients	50 µL NI-SUMO1 5mM DTT	50 µL CI-TRX 5mM DTT	100 µL NI-SUMO1 100 µL CI-TRX	100 µL NI-SUMO1 100 µL CI-TRX 5mM DTT

- took 20 µL samples of each tube directly and then each hour (T0-T4), added 5 µL 5xSDS-Buffer and cooked 10 min at 95°C

 

- performed the following PCRs:

PCR-Programm: C-Int BB for Sec-Tag Insertion:

Master Mix (50µL)

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19BB C-Int BB T7 Term fwd	2.5 µL	0.5 µM
Primer: oIG19BB C-Int for sfGFP rev	2.5 µL	0.5 µM
Template DNA (C-Int + BB mut) 0.4ng/µL	2.5 µL	1 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	21 µL	-
High GC-Enhancer	10 µL	1X

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         x30 Extension	96°C 63°C 72°C	30 sec 30 sec 4 min
Final Extension	72°C	10 min
Hold	4°C	-

 

PCR-Programm: N-Int BB for Sec-Tag Insertion:

Master Mix (50µL)

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19BB N-Int for HlyA fwd	2.5 µL	0.5 µM
Primer: oIG19BB N-Int for HlyA rev	2.5 µL	0.5 µM
Template DNA (N-Int + BB mut) 0.4ng/µL	2.5 µL	1 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	21 µL	-
High GC-Enhancer	10 µL	1X

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         x30 Extension	96°C 68°C 72°C	30 sec 30 sec 5 min 30 sec
Final Extension	72°C	10 min
Hold	4°C	-

 

PCR-Programm: HlyA Insert (for N-Intein):

Master Mix (50µL):

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19BB HlyA fwd 10µM	2.5 µL	0.5 µM
Primer: oIG19BB HlyA rev 10 µM	2.5 µL	0.5 µM
Template DNA HlyA 0.3 ng/µL	1 µL	0.3 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	32.5 µL	-

 PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         30x Extension	96°C 65°C 72°C	30 sec 30 sec 20 sec
Final Extension	72°C	3 min
Hold	4°C	-

 

PCR-Programm: sfGFP Insert (for C-Intein):

Master Mix (50µL):

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19BB sfGFP fwd 10µM	2.5 µL	0.5 µM
Primer: oIG19BB sfGFP rev 10 µM	2.5 µL	0.5 µM
Template DNA sfGFP 0.3 ng/µL	1 µL	0.3 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	32.5 µL	-

 PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         30x Extension	96°C 66°C 72°C	30 sec 30 sec 40 sec
Final Extension	72°C	3 min
Hold	4°C	-

 

---

 

14.08.2019

- performed the following PCR:

PCR-Programm: C-Int for Sec-Tag Insertion:

Master Mix (50µL)

reagent	amount	concentration
5X Q5 Reaction Buffer	10 µL	1X
10 mM dNTPs	1 µL	200 µM
Primer: oIG19BB C-Int BB T7 Term rev	2.5 µL	0.5 µM
Primer: oIG19BB C-Int for sfGFP fwd	2.5 µL	0.5 µM
Template DNA (C-Int + BB mut) 0.4ng/µL	2.5 µL	1 ng
Q5 High-Fidelity DNA Polymerase	0.5 µL	0.02 U/µL
Nuclease-Free Water	21 µL	-
High GC-Enhancer	10 µL	1X

PCR Programm:

Step	Temp.	Time
Initial Denaturation	96°C	1 min
Denaturation         Annealing         x30 Extension	96°C 67°C 72°C	30 sec 30 sec 1 min
Final Extension	72°C	10 min
Hold	4°C	-

 

- performed an SDS-PAGE with the samples of the 12.08 (12% Gel, 1 h 20 min, 80 V):

ladder

Tube 2 - T0

Tube 1 - T0

Tube 3 - T0

Tube 4 - T0

Tube 4 - T1

Tube 4 - T2

Tube 4 - T4

Tube 3 -T4

- the Gel leaked at one side, so the ladder could not be used, after blotting and antibody staining (15.08) no bands could be identified and we found out that we used cells for the expression, that were not able to work with the T7 Promotor of our construct

- Gelelectrophoresis( ladder, HlyA, NI-BB, sfGFP, CI, CI-BB) 1 h, 1% Agarose, 120 V:

- all bands had the correct size besides NI-BB in lane 4 (no product)

 

---

 

15.08.2019

- repeated the PCR of NI-BB with a touchdown Program (72 - 57 °C), Gelelectrophoresis showed: did not work

- tranformed Rosetta cells with the NI-SUMO1 and the CI-TRX Plasmid and plated them, incubated at 37°C over night

 

---

 

16.08.2019

- repeated the PCR of NI-BB with a touchdown Program (62-57 degrees) and 10% DMSO, Gelelectrophoresis showed: did not work

- picked colonies from the transformed Rosetta cells, incubated in 2 mL LB-Medium + Amp overnight at 37°C

 

---

 

18.08.2019

- measured OD of the Rosetta cells and put the amount of bacteria into 4 mL of LB -medium to have OD 0.1, incubated 2 hours at 37°C

- after 2 h added IPTG with 1mM end concentration, incubated 3 more hours then pelletized and stored pellets over night at -80°C

 

---

 

20.08.2019

- prepared Reaction Buffer K: 100mM Tris (pH 7.5), 5mM DTT, 1mM EDTA

- resuspended pellets from yesterday in 300 µL Reaction Buffer K, sonicated the cells (4x 8 cycles of 1 min, max volume)

- centrifuged 15 min, 4°C, max speed

- prepared 4 tubes:

tube	1	2	3	4
ingredients	300 µL CI-TRX	300 µL NI-SUMO1	300 µL NI-SUMO1 300 µL CI-TRX	300 µL NI-SUMO1 300 µL CI-TRX (both in lysis buffer instead of Reaction Buffer K)

- took 20 µL samples of each tube directly and then each hour (T0-T4), added 5 µL 5xSDS-Buffer and cooked 10 min at 95°C

- did a gradient PCR of NI-BB with Q5, from 72 to 57°C

- did a touchdown PCR of NI-BB with Phusion 2xMM with and without 10% DMSO  (66-61°C and 63-58°C)

 

---

 

21.08.2019

- Gelelctrophoresis of all PCR tubes from yesterday showed not one band :(

- Did a SDS-PAGE with the following samples (1 h 10 min, 100 V, 12% Gel):

Tube 1- T0

Tube 2- T0

Tube 3-T0

Tube 4-T0

ladder

Tube 3- T1

Tube 3- T2

Tube 3- T3

Tube 3- T4

Tube 4- T4

- Blotted 30 min, 1A, semi-dry

- Blocked 1 h with 5% BSA

- Incubated 1 h with 1. ABs (Rabbit anti SUMO1: 1/5000 and Mouse anti TRX1: 1/2000) at room temp.

- wash 3x in PBST

- Incubated 1 h with 2. ABs (Goat anti Rabbit-Cy5: 1/2000 and Goat anti Mouse Alexa Flour 488: 1/2000)

- wash 3x in PBST

- Took flouressence pictures, TRX:

- lowest band is at 17kDa and should show CI-TRX, the band of a splice product(SUMO1-TRX) should be at 24kDa and cannot be seen

 

---

 

22.08.2019

- Did a gradient PCR of NI-BB with Phusion (52-62°C), gelelectrophorsis showed no bands, orderd new primers with shorter overhangs, bringein in the wanted overhangs in 2 PCRs in a row

 

---

 

23.08.2019

- Did a SDS-PAGE with the samples from 20.08 (1 h 10 min, 100 V, 12% gel):

ladder

tube 1-T0

tube 2-T0

tube 3-T0

tube3-T4

- stained 30min with FastBlue Comassie staining:

- The C-Int-TRX can be seen in tube 1 and 3 at 17kDa, but the N-Int-SUMO cannot be seen at 24kDa and has not been overexpressed

- picked colonies of Rosetta cells with CI-TRX and NI-SUMO and cultured them in 2 mL LB with Amp overnight at 37°C

 

---

 

25.08.2019

- did a PCR-Purification of HlyA(46 ng/uL), sfGFP(41 ng/uL), CI(37 ng/uL) and CI-BB(30 ng/uL) from 14.08.

- did a Gibson assembly (following: https://international.neb.com/protocols/2012/09/25/gibson-assembly-master-mix-assembly) with CI-BB, CI and sfGFP

- did a Transformation with TOP10 cells, plated them on agar plates with Amp. and incubated them at 37°C overnight

- took the cultures with CI-TRX and NI-SUMO fom yesterday and put the amount of culture into 6x 5ml LB medium to have an OD600 of 0.1 in each, incubated them
all 2 h at 37°C, then induced them in different ways:

tube	1	2	3	4	5	6
construct	NI-SUMO	NI-SUMO	NI-SUMO	NI-SUMO	CI-TRX	CI-TRX
induction/incubation	no IPTG/ 25°C o.n.	1mM IMPTG/ 25°C o.n.	no IPTG/ 18°C o.n.	1mM IMPTG/ 18°C o.n.	no IPTG/ 25°C o.n.	1mM IMPTG/ 25°C o.n.

 

---

 

26.08.2019

- pelletized each culture: 2x 2 mL: pellet into the freezer (-80°C) and 1 mL: resuspended in 100 uL Reaction Buffer K

- lysed the resuspended pellets via sonication: 4 times 6 cycles of 1 min with, max volume

- centrifuged them 15 min at 4°C with max rpm

- took 20 uL of the supernatant and denatured them with 4x SDS Buffer and at 95°C for 10 min

- loaded the samples on a 12% SDS-Gel in the following order: ladder, tube1-6

- let run gel 1 h 10 min at 100 V, stained 30 min with InstantBlue™ Protein Stain

- took picture:

- can see no difference between the induced and uninduced samples at the expected size, maybe NI-SUMO builds inclusion bodys

- picked 3 colonies of the TOP10 cells with the sfGFP-CI construct from yesterday, incubated them in 2 mL LB + Amp o/n

 

---

 

27.08.2019

- took a 2 mL pellet of tube 1 and 2 (from 25.08, to check if mutation occur after induction) and the 3 sfGFP-CI cultures from yesterday, performed a mini prep and send DNA to sequencing

 

 

---

 

28.08.2019

- took a 2 mL pellet of tube 1 and 2 (from 25.08), resuspended them in 200 uL Reaction Buffer K, sonicated the cells with 4x 6 cycles of 1 min at max volume

- took a 20 uL sample of the whole lysate of tube 2 (ind. NI-SUMO1) and denatured it with Laemmli-Buffer and at 95°C for 10 min

- centrifuged the lysates 15 min, max rpm, 4°C

- took 20 uL samples of the supernatant and the resuspended debris of lysate of tube 2 and a 20 uLsample of the resuspended debris of the lysate of tube 1 and denatured them with Laemmli-Buffer and at 95°C for 10 min

- loaded samples on a 12% SDS-Gel: ladder / tube 2 lysate / tube 2 SN / tube 2 debris / tube 1 debris   /   ladder / tube 2 lysate / tube 2 SN / tube 2 debris / tube 1 debris

- let run 1 h, 100 V

- cut the gel in the middle, blotted halves separately on PVDF membranes (30 min, 1 A, semi dry) then blocked both membranes with 5% BSA in TBST o/n at 4°C

- sequencing showed that sfGFP-CI was assembled successfully, inserted TRX into sfGFP-CI with Golden Gate Assembly:

Master Mix (each): 3:1 (Insert:Backbone(150ng)), 1.5 µL T4 DNA Ligase Buffer, 9.2 µL dH20 (filled up to 15 µL), 1µL BsaI, 1µL T4 DNA Ligase

Cycler Program:

Step	Temp.	Time
Restriction                        x25 Ligation	37°C   16°C	3 min   4 min
Final Restriction	50°C	5 min
Denaturation	80°C	5 min
Hold	4°C	-

- tried PCR of NI-BB for Sec-Tag with new Primers: also failed

 

---

 

29.08.2019

- the 2 PVDF were washed 1x 5 min with TBST, then the 1. antibodies were added: 1. Rabbit anti SUMO1 (1:5000) / 2. Mouse anti His-Tag (1:1000) both in TBST with 5% BSA, incubated 2h at RT

- 3x washed with TBST

- 2. antibodies were added: 1. Goat anti Rabbit Cy5 (1:2000) / 2. Goat anti Mouse 488 (1:2000) both in TBST with 5% BSA, incubated 2h at RT

- washed 3x with TBST, took picture with Amersham™ Typhoon™Biomolecular Imager:

- lane 2 and 3 show in both stainings that the main amount of SUMO1 (band at 24kDa) stayed in the debris and possibly is building inclusion bodies, decided to use Maltose binding Protein instead (MBP)

- transformed competent TOP10 cells with the sfGFP-CI-TRX construct from the Golden Gate Assembly from yesterday, plated on Agar + Amp, incubated at 37°C o/n

 

---

 

30.8.2019

- Picked 3 colonies (C-int 1, C-int 2, C-int 3)

- Inoculated them  in LB+Amp (4 mL), incubated at 37°C, 220 rpm for 8 hours

- Picked a Colony from MBP (pMal) plate (obtained from BIOSS Toolbox, University Freiburg) and incubated in 4 mL LB+Amp for 7 hrs at 37°C, 220 rpm

- Did a mini prep of 1 mL of cultures

- Eluted in 30 uL Elution Buffer

- Sent 20 uL of eluates to sequencing

 

---

 

31.8.2019

- PCR of MBP fragment

Reagent	Amount
2X Q5 Mastermix	25 uL
oIG19BB MBP forward primer	2.5 uL
oIG19BB MBP reverse primer	2.5 uL
Template DNA MBP	1 uL
dH2O	19 uL

 

- did a gel electrophoresis (bands at 1.2kb as expected)

- PCR purification with the rest in the PCR-tube

 

---

 

02.09.2019

- Inserted MBP into N-Int + BB mut with Golden Gate Assembly:

Master Mix (each): 3:1 molarity (Insert:Backbone(150ng)), 1.5 µL T4 DNA Ligase Buffer, 0.2 µL dH20 (filled up to 15 µL), 1µL BsaI, 1µL T4 DNA Ligase

Cycler Program:

Step	Temp.	Time
Restriction                        x25 Ligation	37°C   16°C	3 min   4 min
Final Restriction	50°C	5 min
Denaturation	80°C	5 min
Hold	4°C	-

 - transformed competent  TOP10 cells with 3/6 µL of the Golden Gate Product, plated, let grow o/n at 37°C

- repeated PCR of NI-BB mut for Sec-Tag with Phusion Flash Polymerase, gelelectrophoresis: no band

- Sequencing of sfGFP-CI-TRX showed that the construct was assembled correctly

- transformed competent BL21(DE3) cells with the sfGFP-CI-TRX construct, plated them on Agar plates + Amp, incubated o/n at 37°C

 

---

 

03.09.2019

- barely colonies grown from the with NI-MBP transformed cells, picked 3 and cultured in 4 mL LB + Amp, Mini prep after 8 h, send to Sequencing

- no BL21(DE3) cells with sfGFP-CI-TRX did grow, realized that competent cells have been defrozen several times before, repeated transformation with new competent BL21(DE3) cells

- tried gradient PCRs with DMSO, with GC-Enhancer, under normal conditions of the NI + BB mut for Sec-Tag construct, all failed

 

---

 

05.09.2019

- colonies of BL21(DE3) cells with sfGFP-CI-TRX did grow, picked one and cultured in 8 mL LB + Amp o/n, 37°C, 200 rpm

- sequencing of the NI-MBP constructs show that MBP was not inserted, found a BsaI restriction site in the MBP sequence, ordered phosphorylated primers to insert a point mutation

 

---

 

06.09.2019

- prewarmed 500 mL of LB-medium + Amp.

- added the BL21(DE3) culture with the sfGFP-CI-TRX construct to have 500 mL culture with OD 0.1, incubated at 37°C, 200 rpm until OD 0.5

- took 15x 20 mL samples, centrifuged them 10 min at 3000 g, discard SN, resuspend pellet in 20 mL LB+Amp (12x) or in Auto-Induction Medium+Amp (3x) and put them in 100 mL erlenmayer flasks

- induced the cultures with different concentrations of IPTG and then let them incubate at different temperatures, at 200 rpm and for different period of times:

flask	medium	induction	temperature	induction time
1	LB	1mM IPTG	37°C	16 h
2	LB	1mM IPTG	30°C	16 h
3	LB	1mM IPTG	25°C	24 h
4	LB	0.5mM IPTG	37°C	16 h
5	LB	0.5mM IPTG	30°C	16 h
6	LB	0.5mM IPTG	25°C	24 h
7	LB	0.1mM IPTG	37°C	16 h
8	LB	0.1mM IPTG	30°C	16 h
9	LB	0.1mM IPTG	25°C	24 h
10	LB	no IPTG	37°C	16 h
11	LB	no IPTG	30°C	16 h
12	LB	no IPTG	25°C	24 h
13	auto induction	-	37°C	16 h
14	auto induction	-	30°C	24 h
15	auto induction	-	25°C	48 h

- after induction time, measure OD of each flask, take 1 mL samples, centrifuge them 1 min at max speed, take supernatant and resuspend pellet in LB+Amp, measure flourescence of each samples SN and pellet with 2x 200 µL in the platereader at 495 nm excitation and 515 nm emission

- also take 40 µL of each supernatant and denature it with 4x Laemmli Buffer and at 95°C for 10 min

 

---

 

08.09.2019

- results of the sfGFP experiment:

 

 

 

 

- LB-medium, 37°C, 0.1 mM IPTG, 16 h looks the most promising

 

---

 

11.09.2019

- to verify that not just sfGFP was in the mdium, but also the CI-TRX construct linked to it, performed SDS-Page and Western Blot with the denatured samples in the following lanes:

 LB-medium / SN 37°C unind. / pellet 37°C 1mM (1:20) / SN 37°C  1mM / SN 37°C 0.5 mM / ladder / SN 37°C 0.1 mM / SN 37°C auto-ind. / SN 30°C auto-ind. / SN 25°C auto-ind.

- let run on 12% SDS-Gel for 1 h 10 min, 100 V

- blotted on PVDF membrane (30 min, 1 A), blocked with 5% BSA (2 h), washed 1x with TBST, added 1. antibody (Mouse anti TRX 1:1000) in 10 mL TBST with 5% BSA (1 h), washed 3x with TBST, added 2. antibody (Goat anti Mouse 488 1:2000) in 10 mL TBST with 5% BSA (1 h), washed 3x with TBST, took picture with Amersham™ Typhoon™Biomolecular Imager at 488 nm:

div class="centerimgs">