Short description of what has been done
04.06.19
- Made 1:10 dilutions of all primers
| Primers | Cloning of Droplet forming proteins | TM °C | Ta °C | ||
| Name | Tube name | Sequence (overlap/spacer/ANNEAL) | Use | ||
| pBAD33_fwd | pBAD33_sfGFP_gibson_f | gctctacaaaTAAATCGATCGCGTTAGG | Gibson primer to join sfGFP and the start of the pBAD33 Backbone ( | 58.5 | 56.1 |
| pBAD33_rev | pBAD_FUS_gibson_rev | tagacgccatGCTAGCATTATACCTAGG | Gibson primer to join FUS and the end of pBAD33 Backbone | 55.1 | 56.1 |
| FUS_fwd | FUS_pBAD33_gibson_fw | taatgctagcATGGCGTCTAATGACTACACTCAGC | Gibson primer to join FUS and the end of pBAD33 Backbone (reverse) | 68.3 | 69.3 |
| FUS_rev | FUS_sfGFP_gibson_rev | cggatcctccGTATGGGCGCTCGCGACG | Gibson primer to join FUS and the sfGFP with linker(reverse) | 72.4 | 69.3 |
| linker_spGFP_fwd | gsGFP_pBAD33_gibson_f | gcgcccatacGGAGGATCCGGAGGATCC | Joins the start of sfGFP to the end of fus | 67.0 | 65.6 |
| linker_spGFP_rev | spGFP_pBAD33_gibson_r | gatcgatttaTTTGTAGAGCTCATCCATGCC | Gibson primer to join sfGFP and the start of the pBAD33 Backbone | 64.6 | 65.6 |
| SPD5 | |||||
| pBAD33_fwd | pBAD_SPD5_fwd | gctctacaaaTAAATCGATCGCGTTAGG | Gibson primer to join stGFP and the start of the pBAD33 Backbone | 58.5 | 56.1 |
| pBAD33_rev | pBAD33_SPD5_gibson_rev | tatcttccatGCTAGCATTATACCTAGG | Gibson primer to join stGFP and the start of the pBAD33 Backbone (reverse) | 55.1 | 56.1 |
| SPD5_1_fwd | SPD5_pBAD33_gibson_fwd | taatgctagcATGGAAGATAACTCTGTCCTTAATGAAG | Gibson primer to join SPD5_1 at the end of pBAD33 | 63.5 | 64.5 |
| SPD5_1_rev | SPD5_1_gibson_rev | gtgcaatagtGAAACGACGCGACGCTTC | Gibson primer to join SPD5_1 at the end of pBAD33 (reverse) | 67.2 | 64.5 |
| SPD5_2_fwd | SPD5_2_gibson_fw | gcgtcgtttcACTATTGCACCGGATGCTG | Gibson primer to join SPD5_2 at the end of SPD5_1 | 65.2 | 62.6 |
| SPD5_2_rev | SPD5_2_sfGFP_gibson_rev | cggatcctccCTTCTTGCGAATTTCCTTTACG | Gibson primer to join SPD5_2 at the end of SPD5_1 (reverse) | 61.6 | 62.6 |
| linker_spGFP_fwd | sfGFP_SPD5_2_gibson_fw | tcgcaagaagGGAGGATCCGGAGGATCC | Forward primer for sfGFP (at the end of SPD5) | 67.0 | 65.6 |
| linker_spGFP_rev | sfGFP_pBAD33_gibson_rev | gatcgatttaTTTGTAGAGCTCATCCATGCC | Reverse primer GFP at the start of pBAD | 64.6 | 65.6 |
| mCherry | |||||
| pBAD33_fwd | PBAD33_mCherry_gibson_fwd | cgagctgtacTAAATCGATCGCGTTAGG | Gibson primer to join mCHERRY and the start of the PBAD33 Backbone | 58.5 | 56.1 |
| pBAD33_rev | pBAD_EWSR1_gibson_rev | ttgaggccatGCTAGCATTATACCTAGG | Gibson primer to join mCHERRY and the start of the PBAD33 Backbone (reverse) | 55.1 | 56.1 |
| EWSR1_fwd | EWSR1_pBAD33_gibson_fwd | taatgctagcATGGCCTCAACTGACTACTC | Gibson primer to join EWSR1 and the end of the PBAD33 Backbone | 63.7 | 64.7 |
| EWSR1_rev | EWSR1_mCherry_gibson_rev | ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG | Gibson primer to join EWSR1 and the end of the PBAD33 Backbone (reverse) | 67.1 | 64.7 |
| GS_mCherry_fwd | mCherry_EWSR1_gibson_fwd | tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG | Gibson primer to join mCHERRY and the end of the EWSR1 | 68.8 | 66.9 |
| GS_mCherry_rev | mCherry_pBAD33_gibson_rev | gatcgatttaGTACAGCTCGTCCATGCC | Gibson primer to join mCHERRY and the end of the EWSR1 (reverse) | 65.9 | 66.9 |
| NiCD | |||||
| pBAD33_fwd | pBAD33_sfGFP_gibson_fwd | tgagctctacaaaTAAATCGATCGCGTTAGGC | Gibson primer to join sfGFP and the start of the PBAD33 Backbone | 57.1 | 60.4 |
| pBAD33_rev | pBAD33_NICD_gibson_rev | tgacgcattcatGCTAGCATTATACCTAGGACTG | Gibson primer to join sfGFP and the start of the PBAD33 Backbone (reverse) | 56.9 | 60.4 |
| NICD_fwd | NICD_pBAD33_gibson_fwd | gtataatgctagcATGAATGCGTCATGTGTAGGGG | Gibson primer to join NICD at the end of pBAD33 | 62.5 | 65.6 |
| NICD_rev | NICD_sfGFP_rev | ctcctttgctcatggatcctccggatcctccGACCAGATGGCCGCGCAG | Gibson primer to join NICD at the end of pBAD33 (reverse) | 65.7 | 65.6 |
| sfGFP_fwd | sfGFP_NICD_fwd | ggccatctggtcggaggatccggaggatccATGAGCAAAGGAGAAGAACTTTTC | Gibson primer to join sfGFP at the end of NCID | 59.1 | 60.8 |
| sfGFP_rev | sfGFP_pBAD33_rev | gcgatcgatttaTTTGTAGAGCTCATCCATGC | Gibson primer to join sfGFP at the end of NCID (reverse) | 57.3 |
60.8 |
Ordered gBlocks sequences:
EWSR1 (Ewing Sarcoma Breakpoint Region 1):
atggcctcaactgactactccacttactcgcaggcagcagcacagcaaggctacagcgcttatacagcccagccaacgcaaggatatgcccaaacaacgcaggcatacggtcagcagtcttacggcacttacggccagccaactgatgtctcttacactcaagctcagaccacagcgacttatggccagaccgcatatgccacctcttacggtcagcccccgaccgtggaaggaacgtcgactggctatacaactccaaccgctcctcaagcatacagccagccagtccaaggatatggaaccggtgcatacgatacaacaactgccacagtgacgactacacaggcttcttatgcagctcagagtgcatatgggactcaaccagcatacccggcatacggccagcagccagctgcaacagctccaacgcgtcctcaggatggcaacaagccaacagagacctcgcaaccccagtccagtacaggtggctacaatcagccctccttggggtatgggcagagtaactactcgtacccccaagtccccggttcttaccctatgcagcctgtcacggcgcccccgagctatccacctacctcctatagcagtacgcagcccacgtcatatgatcagtcctcatattcccagcaaaacacatatgggcaacctagcagttatggccagcagtcttcgtacgggcagcagtcatcgtatggacagcaacctccgacatcatatccaccacagaccggatcgtactctcaggcaccatcacaatattctcagcaatcatcgtcatacggtcagcagtcttcttttcgtcaggatcatccttcttcgatgggtgtatatggccaagaatcggggggattctctggaccgggtgagaaccgtagtatgtcaggcccagacaaccgtggccgtggtcgtggcggtttcgatcgtggtggcatgtcgcgcggtgggcgtggtgggggccgcgggggtatgggggcaggggagcgtggtgggtttaacaaaccaggtggaccgatggatgagggcccagatcttgacttgggtccaccagtcgatccggatgaggattcagacaatagtgcaatttacgtgcaggggttaaatgactccgtgacgctggatgatctggccgatttcttcaaacaatgcggcgtagtaaaaatgaataaacgcacaggtcaacccatgattcatatctacttggacaaagagactggcaaaccaaaaggagacgctacggtatcatatgaggaccctccaacagctaaagccgctgttgagtggtttgatggaaaagacttccagggaagcaaattaaaggtatcattagcgcgtaaaaaaccacctatgaactcaatgcgcggcggactgccgccccgcgaaggtcgtggtatgccaccgccacttcgtggaggacctggaggtccaggaggtccaggtggtcctatgggacgaatgggaggtcgtggcggcgaccgcgggggttttcctccgcgcgggccccgtggtagtcgtggtaacccttcagggggcggcaacgtgcaacatcgcgcaggcgattggcagtgtccaaacccgggttgcggtaatcagaacttcgcgtggcgtacagaatgtaatcagtgcaaagcgccaaaaccagaaggttttcttccacccccgtttccacctccaggcggagaccgtggccgtggagggccgggtggtatgcgcggcggacgcggaggtcttatggatcgcggtggtccgggcgggatgtttcgtgggggtcgcggcggggatcgtggaggtttccgcggaggtcgcggaatggatcgtggcggattcggaggaggacgtcgtggtggtccaggggggcctcctggtcctctgatggagcagatgggagggcgccgcggtggtcgtggcgggccaggcaagatggataaaggtgagcaccgtcaagagcgccgtgatcgtccctatggaggatccggaggatcc
FUS:
atggcgtctaatgactacactcagcaagctacccaatcttatggggcatatccgacccaacctggccaaggctattcccaacagtcatcacaaccttacgggcaacaaagttattccggttacagccagtcaacagatacttctggatatggtcagtcttcctattcgtcatacggtcagagtcagaatacgggttacgggacacaatcaaccccgcaggggtacggttccaccggcggctatggctccagccaatcgagtcaatcaagttatgggcaacaatcttcttatcccggctatggccaacagccggccccgagctccacatccggttcatatggttcttcaagccaatcaagctcgtatggtcagccgcagtcaggaagctattcacagcagccgtcctacgggggacaacaacagagttacggacagcaacagagttataacccaccgcaaggctacgggcagcagaatcagtacaattcctcttcaggtggtggtggtggcggtggtggtggagggaattacgggcaagatcaatctagtatgtcttcaggagggggcagcggtgggggatacggcaatcaagatcaaagtggtggaggtggatctggaggttatggacagcaggatcgtggaggtcgcggccgcggcggctctggtggtggtgggggaggaggaggtggtgggtacaatcgtagctccggaggatacgagccacgtgggcgtgggggcggtcgcggtgggcgcggtgggatgggtggctctgaccgcggcggttttaataagttcggtggtccccgtgatcagggttcacgccacgatagtgagcaagacaacagtgataacaatacgatcttcgttcaaggtcttggagagaacgttacaattgaatcggtagcagactatttcaaacagattggtattattaaaaccaacaagaagacaggccaaccgatgattaacttgtatactgaccgtgaaaccggtaaattaaaaggggaggctaccgtatcctttgacgaccctccaagcgcaaaagctgccattgactggtttgacggtaaagaattttctggcaacccgattaaggtgtccttcgcaacacgccgtgcggacttcaaccgtggcggggggaacggacgtggggggcgcggccgcggaggtccaatggggcgcggagggtatggaggaggaggcagtggtgggggtggacgtggtggtttccccagcggcggcggaggaggaggcggtcagcaacgtgccggtgattggaagtgtcctaatccaacctgcgaaaatatgaacttctcttggcgcaatgagtgtaaccagtgcaaggcaccgaaacctgatggcccaggtggcgggccagggggaagccacatgggcggaaattacggtgatgatcgtcgcggcggccgtgggggatacgaccgtggtggctatcgtggccgtggtggagatcgcggtggcttccgtggtgggcgcggaggaggtgaccgcggagggtttgggccggggaagatggacagccgtggcgaacaccgtcaagatcgtcgcgagcgcccatac
NICD (Nephrin Intracellular Domain)
atgaatgcgtcatgtgtagggggtgtgatttggcagcgccgtattcgccgtctggccgaaggaatttcggaaaaaacagaagccggttccgaggaggaccgtgttcgtaatgaatacgaagaatcgcaatggaccggtgagcgcgatacgcaatctagtaccgtatccacgacagaagcagagccttattatcgcagtatccgcgatgaaagtccacagcttcctcctacacaggaagaggtttcctatagccgtggcgaaactggggaggatgaggatatggcagagccgggtcacttgtacgatgaggtagagcgcacttacccacctagcggcgcatggggtcccctgtacgatgaagtccagatggggccctgggatctgcattggcctgaggacacttatcaagaccctcgcggaatctatgaccaggttgcgggcgatcttgacactctggagcctgattcgctgccgtttgagctgcgcggccatctggtcggaggatccggaggatcc
SPD5:
atggaagataactctgtccttaatgaagatagtaaccttgagcacgtcgaaggtcagcctcgtcgtagtatgtctcaaccagtactgaatgtcgaaggtgacaagcgcacttctagcacaagtgcaacacagcagcaagttctttccggtgcgttctcttccgctgatgtccgctcaattccgatcatccaaacgtgggaagaaaacaaggctttgaaaacgaagatcacaattcttcgcggtgagctgcaaatgtaccaacgccgctatagtgaagccaaggaggcaagccagaagcgtgtcaaagaggttatggatgactatgtggacttaaaattaggtcaagaaaatgtacaagagaagatggaacaatacaagttaatggaagaagacttattggcgatgcaatcccgtattgaaacgtcggaagataatttcgcgcgtcagatgaaggaatttgaagcccaaaaacatgccatggaagaacgtattaaggagttggaactttccgccaccgatgctaacaacactacagtaggtagttttcgcgggacgcttgacgatatcttgaagaagaacgaccccgactttaccttaacctccggatatgaagaacgtaagatcaatgacttagaagccaagttacttagcgaaatcgataaggtggcagaactggaggaccacatccagcagttgcgccaagaacttgatgatcaaagtgcgcgcttagctgattcagagaacgtgcgcgctcagctggaagcggctaccggacaaggaatcttgggagctgctgggaatgcaatggtcccaaattcaacgttcatgatcgggaacgggcgcgaatctcaaacgcgcgatcagttgaattacatcgatgatttggaaactaagcttgcagatgctaagaaggaaaatgacaaggcccgtcaggccttagtggagtatatgaataaatgttcaaagcttgaacacgagatccgcactatggtaaagaatagtacgtttgacagctcatcaatgttattgggcggtcagaccagcgacgaattaaagattcagattggaaaggtaaatggagaattaaacgtacttcgcgccgagaatcgcgagcttcgcattcgctgcgatcaacttactggaggggacggtaacctttctatcagtcttggccaaagtcgtctgatggctgggattgctacaaacgatgtggatagtattggccaagggaatgaaaccggcgggacgagtatgcgtatcttgccacgcgagtcgcagttagacgacttggaagaaagtaagttgcctttaatggatactagtagtgcggtccgcaaccaacaacagttcgccagcatgtgggaagattttgagtccgtgaaagactcactgcaaaacaaccataacgacacccttgagggctcgtttaatagtagtatgccacccccagggcgcgatgccacccagtcatttctttctcagaaatcttttaagaatagcccaattgtgatgcaaaagccgaagagcttacacttgcaccttaagtcacatcagagcgagggggcgggggagcagattcagaataatagtttctctactaagacggcgagtccgcatgtctcccagagccatatcccaatccttcacgacatgcaacaaattctggactcatcggcgatgtttttagaaggtcaacacgacgttgcagttaatgtggaacaaatgcaagaaaagatgtctcagattcgcgaggcccttgcgcgcttgttcgagcgcctgaaatcgagtgccgcattattcgaggaaattctggaacgcatgggcagttcagatccaaacgccgataagattaaaaaaatgaagttagctttcgagacgtcgatcaacgataaattaaacgtgtctgctattcttgaggcggccgagaaggatttacataacatgagcttaaacttttcaatcttagagaagagtatcgtaagccaagctgccgaagcgtcgcgtcgtttcactattgcaccggatgctgaagacgttgcatccagttctcttcttaatgcgagttactcgccgttgtttaagtttacttccaactccgatatcgttgaaaagcttcagaatgaagtctcagaacttaaaaacgagttagagatggcacgcacacgtgatatgcgcagcccccttaacggatcttccgggcgtcttagtgacgtgcagatcaacacaaaccgcatgtttgaagatcttgaggtatccgaggcaacgcttcagaaggccaaggaagagaactccactctgaaatcacagtttgctgagcttgaggcgaacttgcaccaggtgaattctaagttaggggaggtgcgctgcgagttaaatgaggccttggcccgtgtggacggagagcaagagactcgtgtaaaggctgagaacgcgttagaagaagctcgccaattgatttcttcccttaaacatgaggaaaatgagttaaagaagactattactgatatggggatgcgtcttaatgaagcaaaaaagtccgacgagttcctgaaatccgagctttctaccgctttggaggaggagaaaaaatcccaaaatttagcagacgagttgtcagaggaacttaacggttggcgtatgcgtacgaaggaagcggagaataaagtagaacatgcgtcctcggagaagagcgagatgctggaacgtatcgtgcatcttgaaacggaaatggagaagctgtcaacctctgaaattgcagcggactattgttctacgaagatgactgagcgcaaaaaggaaattgagttggcaaagtaccgcgaagattttgagaacgccgctattgtgggcctggaacgtatttcaaaagaaatctctgagttaactaagaagacactgaaggcaaagatcattccatcgaacatctcaagcatccagcttgtctgcgatgagctttgccgtcgtctgtcacgcgagcgcgagcaacaacacgaatacgccaaggttatgcgtgacgtcaatgagaagatcgaaaaattgcaattagaaaaagatgcgttggaacacgagttgaaaatgatgtcaagtaataatgaaaacgtgcctcctgtcgggacttcagttagcggcatgccgacaaagacgagtaatcaaaaatgcgcgcaaccacactacacgtcaccgactcgccaacttctgcatgagtcaaccatggcggtcgacgcgattgtccagaaattgaagaaaacacacaacatgagcgggatgggaccagagttgaaagaaacaattggtaacgtgatcaacgaatcacgtgtcttgcgcgactttcttcatcaaaagcttattttgtttaagggcattgatatgtctaattggaagaatgaaacggttgatcagctgatcaccgatttaggccagctgcaccaggacaatctgatgttggaagaacagatcaagaaatataaaaaggaacttaagcttaccaaaagtgcgatccctactcttggagtggaattccaggatcgtattaagaccgaaattgggaaaattgcgacggacatgggcggagccgtaaaggaaattcgcaagaag
| Created Plasmids in first cloning phase | |||||
| Backbone | Insert | Insert | Promoter | Resistance | |
| P1 | pBAD33 | EWSR1 | mCherry | J23119 | Chloramphenicol |
| P2 | pBAD33 | FUS | sfGFP | J23119 | Chloramphenicol |
| P3 | pBAD33 | SPD5 | sfGFP | J23119 | Chloramphenicol |
| P4 | pBAD33 | NICD | sfGFP | J23119 | Chloramphenicol |
</p>
Contents
05.06.19
<!DOCTYPE html>
Labbook 05.06.2019
Performed amplifications of the Backbones (all Plasmids will be constructed with a pBAD33 backbone), sfGFP and mCherry genes from plasmids.
Following PCR constructs were made:
For FUS: (A) pBAD amplification with Primers 1&2* (not successful)
(B) sfGFP amplification with Primers 5&6*
For SPD5: (D) pBAD amplification with Primers 7&8* (not successful)
(E) sfGFP amplification with Primers 13&14* (not successful)
For EWSR1: (H) pBAD amplification with Primers 15&16*
(I) mCherry amplification with primers 19&20*
*For sequences of primers and roteins see Protocol from Day 04.06.2019
PCR tubes contained: 2,5 μl of each primer (diluted 1:10)
1 μl DNA
19 μl H2O
25 μl Phusion Flash Master Mix (Thermo Fisher Scientific)
Fragments B, H and I were successfully amplified, identified via Gel electrophoresis and purified.
PCR for DNA fragments A, D and E were set up again. To troubleshoot the PCRS, higher Backbone concentrations of about 2 ng were used. Also for fragment E, 3% of DMSO were added to the PCR mix. Also, two different Polymerases were used (Q5 and Phusion Flash).
Furthermore, constructs amplifying pBAD33 (A and D) were incubated overnight with 0,5μl DPN1 enzyme at 37°C to digest methylated bacterial DNA.
All amplifications and purifications were successful. Unfortunately, the PCR image has been lost because of technical issues with the GelViewer.
07.06.19
<!DOCTYPE html>
NICD (Nephrin Intracellular Domain) was amplified, as well as sfGFP and pBAD33 with respective overlaps.
Following PCRS were set up:
(J) pBAD amplification with primers 1&22*
(K) sfGFP amplification with primers 25&6*
(L) NICD amplification with primers 23&24*
*For all sequences see table in protocol from 04.06.2019
All amplifications were successful, see picture below.
Afterwards, gibson cloning was set up. Considering sizes, amound of insert for 50 ng backbone was calculated.
NICD: 17.6 ng
sfGFP: 24 ng
The DNA was diluted with water until reaching 5 microliters of volume and mixed in a 1:1 ratio with a HiFi ligase/exoniuclease mastermix and incubated at 50°C for 15 minutes. Afterwards competent Top10 E. Coli were transformed with 2 microlitres of Gibson Assembly Mix and incubated overnight.
11.06.19
<!DOCTYPE html>
After transformation of NICD was ineffective, proportions were calculated again and ligation was repeated. Incubation overnight follows.
Furthermore, gBlocks for EWSR1, FUS, SPD5_1 and SPD5_2 were amplified to create overlaps with following Primers:
EWSR1 with Primers 17 and 18*
FUS with Primers 3 and 4*
SPD5_1 and SPD5_2 with Primers 9&10 and 11&12 respectively*
*For primer and protein sequences see protocol from 04.06.2019.
Amplification was only successful for SPD5_2 in the first round:
PCR troubleshooting consisted of repeating the reaction with two different polymerases, being Q5 and Phusion Flash, as well as adding 3% DMSO to the DNA mix. In the case of EWSR1, DNA was increased to 2 ng.
In the second round, bands for each sequence could be seen, were cut and purified.
12.06.19
Transformation from the day before was unsuccessful, no colonies were on the plate. We found out we used Ampicillin plates, which is the wrong antibiotic.
Since all required sequences for the designed plasmids (for more information about plasmid constructs see protocol from day 04.06.2019) were now amplified, ligation for all plasmids could now start. The method used was Gibson Cloning. The gibson assemblies were then plated on Chloramphenicol plates and incubated overnight.
13.06.19
<!DOCTYPE html>
Gibson assembly of the Plasmids containing NICD and SPD5, EWSR.
Following constructs were ligated with NEB HiFi Ligase:
Fus: A + B + C (Fus)
EWSR1: H, I, J (EWSR1)
SPD5: D, E, F(SPD5_1) and G (SPD5_2)
Together with the ligated NICD plasmid, all plasmids were transformed into competent E. Coli and plated on chloramphenicol plates.
Plates were incubated overnight at 37°C
14.06.19
<!DOCTYPE html>
Plates containing FUS, SPD5 and NICD from 13.06.2019 had colonies. EWSR1 had no colonies.
Coloies were picked and LB medium with Chloramphenicol was inoculated, bacteria was grown in media for 5 hours and prepared for sequencing.
A second set of media were incoulated and prepared for microscopy. Samples were visualized with a Widefield microscope and analyzed with FiJi. Images attached.
SPD5 sample 2: Dispersed fluroescence (left). No indication for droplets found.


SPD5 sample 1. Lighter spots that can be an indication for droplets in the fluorescent image (Left) that are not visible on the right.


FUS sample 1. Low, dispersed fluorescence (left). No indications for droplets.


NICD sample 1. Low, dispersed fluorescence (left). No indications for droplets.


Problem with NICD: A cloning mistake has led to an excessive atg start codon at the begining of sfGFP, which may give misleading results.
Complementary primers for a site directed mutagenesis deleting the excessive three bases were ordered.
20.06.19
<!DOCTYPE html>
Criteria for identifying if an accumulation of fluorescent proteins are dynamic droplets or dead aggregates:
1. They appear in a concentration dependent manner,
2. They fuse when they encounter another one of their kind,
3. Fluorescence regeneraties after photobleaching (FRAP)
In order to determine whether the results seen in the last protocol are significant, the constructed proteins have to be inducible to be seen under different concentrations.
Cloning steps were repeated so that the constructs could be positioned in front of inducible promoters. Additionally, EWSR1 will be inserted in a different backbone with
compatible origins of replications with the pBAD backbone, so that FUS and EWSR1 can be induced in the same bacteria without competition. The new backbone for
EWSR1 is pTrc99a (empty) with a prc promoter.
Following primers are now added to the list:
| New primers | ||||
| Number | Name | Tube name | Sequence | Description |
| 31 | pBAD33wt_SPD5_FWD | pBAD33wt_SPD5_FWD | TGGATGAGCTCTACAAATAAAAGCTTGGCTGTTTTGGCGG | Primer to amplify new pBAD33(induceable promoter) with right overlaps |
| 32 | pBAD33wt_SPD5_REV | pBAD33wt_SPD5_REV | AGGACAGAGTTATCTTCCATTCTAGAGGATCCCCGGGTAC | Primer to amplify new pBAD33(induceable promoter) with right overlaps |
| 32_2 | SPD5_1_mid_GFP_rev | SPD5_1_mid_GFP_rev | GTGCAATAGTGAAACGACGCGACGC | |
| 33 | SPD5_sfGFP_pBAD33 FWD | SPD5_sfGFP_pBAD33 FWD | GTACCCGGGGATCCTCTAGAATGGAAGATAACTCTGTCCTTAA | Primer to amplify SPD5_1 with the right overlap for new backbone |
| 34 | SPD5_sfGFP_pBAD33 REV | SPD5_sfGFP_pBAD33 REV | CCGCCAAAACAGCCAAGCTTTTATTTGTAGAGCTCATCCATGC | Primer to amplify GFP with the right overlap for new backbone |
| 35 | EWSR1_mCherry_pBAD33 FWD | EWSR1_mCherry_pBAD33 FWD | CATGGAATTCGAGCTCGGTAATGGCCTCAACTGACTACTC | Primer to amplify EWSR1 with the right overlap for new backbone |
| 36 | EWSR1_mCherry_pBAD33 REV | EWSR1_mCherry_pBAD33 REV | GACTCTAGAGGATCCCCGGGTTAGTACAGCTCGTCCATGC | Primer to amplify mCherry with the right overlap for new backbone |
| 37 | pTrc99A FWD | pTrc99A FWD | GCATGGACGAGCTGTACTAACCCGGGGATCCTCTAGAGTC | Primer to amplify pTrc99A (induceable promoter) with right overlaps |
| 38 | pTrc99A REV | pTrc99A REV | GAGTAGTCAGTTGAGGCCATTACCGAGCTCGAATTCCATG | Primer to amplify pTrc99A (induceable promoter) with right overlaps |
| 39 | NICD_sfGFP_pBAD33_FWD | NICD_sfGFP_pBAD33_FWD | GTACCCGGGGATCCTCTAGAATGAATGCGTCATGTGTAGG | Primer to amplify NICD with the right overlap for new backbone |
| 39_2 | NICD_mid_sfGFP_REV | NICD_mid_sfGFP_REV | TCCTTTGCTCATGGATCCTCCGGATCCTC | Primer to amplify NICD with the right overlap for new backbone |
| 40 | NICD_sfGFP_pBAD33 REV | NICD_sfGFP_pBAD33 REV | CCGCCAAAACAGCCAAGCTTTTATTTGTAGAGCTCATCCATGC | Primer to amplify sfGFP with the right overlap for new backbone |
| 41 | pBAD33wt_NICD FWD | pBAD33wt_NICD FWD | TGGATGAGCTCTACAAATAAAAGCTTGGCTGTTTTGGCGG | Primer to amplify new pBAD33(induceable promoter) with right overlaps |
| 42 | pBAD33wt_NICD REV | pBAD33wt_NICD REV | CCTACACATGACGCATTCATTCTAGAGGATCCCCGGGTAC | Primer to amplify new pBAD33(induceable promoter) with right overlaps |
| Primers for NICD atg deletion | ||||
| atg_del_fwd | GATCCGGAGGATCCAGCAAAGGAGAAGAAC | |||
| atg_del_Rev | GTTCTTCTCCTTTGCTGGATCCTCCGGATC | |||
Constructs cotnaining the backbone with inducible promoters will be the following:
FUS, containing the following fragments
| XA | pBAD | w/primers 29&30 | 68°C |
| XB | GFP | w/ primers 5&28 | 63°C |
| XC | FUS | w/ primers 27&4 | 68°C |
SPD5, containing the following fragments
| XD | pBAD | w/primers 31&32 | 68°C |
| XE | GFP | w/primers 13&34 | 63°C |
| XF | SPD1 | w/primers 33&10 | 60°C |
| G | SPD2 |
EWSR1, containing the following fragments:
| XG | pBAD | w/primers 37&38 | 65°C |
| XH | EWSR1 | w/primers 35&18 | 65°C |
| XI | mCherry | w/primers 19&36 | 65°C |
NICD, containing the following fragments:
| XJ | pBAD | w/primers 41&42 | 68°C |
| XK | sfGFP | w/primers 25&40 | 63°C |
| XL | NICD | w/primers 39&24 | 63°C |
21.06.19
<!DOCTYPE html>
Amplifications for the gibson fragments with corrresponding sticky ends were started in order to achieve plasmids with the constructs in front of inducible promoters.
Image left and right: 1% agarose gel with results of amplification of gibson fragments.
All Fragments except EWSR1 gBlock could be successfully amplified. New primers were ordered as part of the troubleshooting procedure.
The new primers are:
| 43 | pTrc99a_rev | pTrc99a_inducible_rev, | ttgaggccatTACCGAGCTCGAATTCCATG |
| 44 | EWSR1_fwd | EWSR1_inducible_fwd, | gagctcggtaATGGCCTCAACTGACTACTC |
| 45 | EWSR1_rev | EWSR1_inducible_rev | ccttgctcacggatcctccggatcctccATAGGGACGATCACGGCG |
| 46 | mCherry_fwd | mCherry_inducible_fwd | tcgtccctatggaggatccggaggatccGTGAGCAAGGGCGAGGAG |
| 47 | mCherry_rev | mCherry_inducible_rev, | gatccccgggGTACAGCTCGTCCATGCC |
| 48 | pTrc99a_fwd | pTrc99a_inducible_fwd | cgagctgtacCCCGGGGATCCTCTAGAG |
25.06.19
<!DOCTYPE html>
Labbook
25/6/19
Repeat PCR for SPD5_1 and FUS and NICD with new primers and extract from agarose gel.
Transform into competent cells and grow overnight culture.
26/6/19
Planning of FRAP experiment
Widefield and Brightfield microscopy of samples
Gibson assembly of FUSinducible (XA, XB, XC)
50 ng of Backbone (1uL)
50 ng sfGFP (2,78 uL)
73 ng FUS (0.73 uL)
Retransformation of bacteria with correctly sequenced constructs (constitutive)
Repeat PCR for NICD and SPD5 fragments
27/6/19
Miniprep of assembled FUS
Repeat PCR of fragments XC, XF, XL, XH and HI (not successful except XC, XF)
Repeat PCR of fragments XH XI and XL with 3% DMSO
Gibson assembly of NICD and SPD5 with correct amplified fragments.
NICD: 50 ng Backbone (0,63 uL)
23,86 ng sfGFP (2,06 uL)
51,14 ng NICD (2,60 uL)
SPD5: 50 ng Backbone (2.5 uL)
sfGFP: 24,68 ng (1,1 uL)
SPD5_1: 68,18 (4,54 uL)
SPD5_2: 51,14 (1,17 uL)
2/7/19
PCR of EWSR1 with primers 17&18, 18&35 and 44&45 in order to amplify EWSR1 constitutive and EWSR1 inducible (twice)
PCR was not successful. Next step is a Touchdown PCR starting at 75°C and going down to 65°C (annealing temperature of the three constructs)
Induceable constructs were retransformed (NICD was made again by Gibson assembly)
Constitutive constructs were retransformed. All retranformations were plated on Chloramphenicol plates and placed overnight in the 37°C incubator.
3/7/19
Colonies were picked and new overnight cultures were prepared from the retransformation of the constructs (induceable and constitutive) for the FRAP experiment.
New Glycerol stocks from all constructs were frozen at -80°C
Glucose free TB medium was mixed, heated and autoclaved in order to prepare the induction and FRAP experiment.
New Chloramphenicol plates were made (LB medium + 400uL 34g/mol Chloramphenicol stock solution added at 50°C)
4/7/19
Microscopy of the working constructs (constitutive FUS, NICD and SPD5 as well as Arbinose-inducible FUS, NICD and SPD5) and the negative control IPTG-inducible
mini eYFP which is known to form aggregates at high concentrations (source: AG Di Ventura, BIOSS Freiburg).
Induction was carried out with the following concentrations:
No induction: E. coli carrying plasmids were grown overnight in TB, diluted to OD 0.01 in the morning, grown to OD 0.5 and further incubated for 2h at 37°C with vigorous shaking.
Induction: E. coli were grown in overnight culture in TB medium, diluted to OD 0.01 in the morning, grown to OD 0.5 and induced with the following concentrations of Arabinose:
LOW: 0.001% Arabinose
MID: 0.05% Arabinose
HIGH: 1% Arabinose
After 2h in the incubater at 37°C and vigorous shaking, miscroscopy was carried out.
At first, samples were analysed with brightfield and widefield GFP microscopy. Cells were checked for droplet like dots.
Most cells didn’t show droplet-like structures, only constitutive SPD5 (as already shown before). Induction seemed to not have worked, since the positive control
plasmid mini eYFP did not show the expected results. Furthermore, general fluorescence of mid and high induced cells was not to be distinguished from low induced cells in most cases.
The constitutive SPD5 probe containing droplet-like structures was analysed under the confocal microscope at 100x. Bleaching was done with 100% laser
intensity with an itinerary of 20. Single droplet like structures were bleached and the Region of Interest (ROI) was analysed, while other ROIs were only analised.
Results did not seem to be clear. Induceable constructs are analysed (sequenced) and microscopy will be repeated in a week.
8/7/19
Touchdown PCR was started with the EWSR1 constructs, amplified with primer pairs 17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)
17&18(constitutive), 18&35 and 44&45 (with the araBAD promoter)
9/7/19
Ordered new gBlocks at twist. Ewsr in two parts. 999bp and 1002bp.
Made new TB buffer.
New cloning for EWSR1:
Kinase reaction on the insert with T4 polynucleotide kinase
Find restriction enzymes
- pTrc99a empty: digest with sma1 (2h)
- Inactivation wth heat (check temperature in NEB): 65°C 20 min
- Column purification of the digested backbone: elute in 20uL of water
- Measure concentration: take 30-50 ng of template
- Take 150 ng of the gblock
- Ligation overnight 4°C with ligase
- Transform 50uL and plate
- Colony PCR to verify (try 10 colonies at first)
Overnight culture in TB medium of constructs FUS3 ind (verified by sequencing), SPD5_1 ind (verified by sequencing) and NICD (not verified) and mini eYFP construct.
New constructs were sent for sequencing
10/7/19
Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5
Retransformation of pTrc99a
Measurement of overnight cultures. All cultures are at an OD of 3,3. All cultures were diluted to an OD of 0.03 and incubated again until reaching OD 0.5
All cultures were split and induced with different levels of arabinose:
NICD: NICD uninduced, NICD low (0.001%), NICD mid (0.05 %) and high (1%)
FUS: FUS uninduced, FUS low (0.001%), FUS mid (0.05 %) and high (1%)
SPD5: SPD5 uninduced, SPD5 low (0.001%), SPD5 mid (0.05 %) and high (1%)
Control: mini eYFP uninduced and induced with 1 mM IPTG
None of the transformations were successful.
11/7/19
Sequencing results show that promoter of the backbones used for the inducible constructs is not AraC but a modified construct. Empty pBad33 plasmid is now
sequenced and restriction site cloning prepared.
Also retransformation of pTrc99a was not successful and will be repeated in order to initialize restriction enzyme cloning of the EWSR1 cloning.
Retransformation ptrc and pbad33 empty as well as backbone for receptor
Pcr of fragments for essays were amplified
FRAP was ameliorated with the constitutive SPD5 construct that has been working since the beginning.
With a pinhole of 65 um, a laser intensity of 100% and 65 itinerations, droplets were bleached and recovery could be observed over time.
12/7/19
13.7.19
Blade light induction
O/N culture with 3 mL of terrific broth
Measurement of OD in the dark with red light lamp. ODs were all 2.0
Dilution of cutures to OD 0.1
Incubation for 1,5h hours to reach OD 0.4
(ODs were too high, between 0.55 and 0.78) -> dilute
Split cultures (1.5 mL), half of them in dark tubes (uninduced), half of them in light tubes (induced).
Transparent tubes were placed in front of blue LED plate (15,5 V) in 37°C shaker.
4h incubation/illumination
2mL on PBS+Agar plates for microscopy
New TB medium: 5g NaCl, 10g Bacto Tryptone and 1 mL of NaOH 1M. Autoclaved.
New overnight culture of FUS (ind), SPD5 (ind), NICD (ind) as well as cells with an empty pBAD (negative control) and a mini eYFP plasmid (positive control)
14. 7.19
Measurement of the 5 cultures’ OD at 8 am, dilution to OD 0.1.
1.5h incubation and measurement of OD. All ODs at 0.4
Split cultures:
NICD: NICD uninduced, NICD induced (4h light), NICD induced (1 % arabinose)
FUS: FUS uninduced, FUS induced (4h light), FUS induced (1 % arabinose)
SPD5: SPD5 uninduced, SPD5 induced (4h light), SPD5 induced (1% arabinose)
Empy pBAD: uninduced / 1% Arabinose
Mini eYFP: uninduced / 1% Arabinose
Incubation for 4 hours.
Subsection Title
Text
Subsection Title #2
Text















