Difference between revisions of "Team:Freiburg/Labbook/Aspartate Racemase"

23.09.2019

PCR of the pBAD backbone (amplification with overhangs)

Gibbson assembly of pBAD backbone and gBlock rac

sequence aspartate racemase:

CACCATCACCATCACCATCACCATCACCATGGTAGCGGTATGAAAACGATAGGTATACTTGGTGGTATGGGTCCGTTAGCTACGGCCGAACTCTTCAGGAGAATTGTCATTAAAACCCCGGCAAAGAGGGATCAGGAACACCCGAAGGTTATAATATTCAATAATCCTCAAATTCCTGATAGAACTGCTTATATTCTTGGTAAAGGAGAAGATCCAAGACCACAACTTATCTGGACGGCTAAAAGACTAGAAGAGTGTGGGGCCGACTTTATAATAATGCCTTGTAACACCGCGCATGCGTTTGTTGAGGATATAAGGAAGGCTATCAAGATCCCCATAATTAGCATGATAGAAGAAACTGCAAAAAAAGTAAAAGAGTTAGGGTTCAAAAAAGCTGGCTTGCTAGCTACTACTGGAACTATAGTGAGTGGAGTTTATGAAAAAGAGTTTTCCAAGTATGGAGTTGAAATCATGACTCCAACGGAAGATGAGCAGAAAGATGTTATGAGAGGGATATATGAGGGGGTTAAAGCCGGGAATTTGAAGCTTGGAAGAGAGCTACTACTTAAGACTGCAAAAATCCTAGAGGAGAGAGGAGCAGAGTGCATAATAGCTGGATGTACCGAAGTTAGTGTAGTTCTTAAGCAGGATGATCTAAAAGTTCCCCTCATAGATCCTATGGATGTTATAGCAGAAGTTGCCGTTAAGGTTGCATTAGAAAAGTAA

Transformation with competent cells (Top 10)

Plated transformed cells and incubated at 37°C

---

24.09.2019

inoculated cells in LB + Chloramp. and incubated at 37°C for 8 h 

→ nothing grew, put plates with transformed cells again in the incubator

---

25.09.2019

plates were covered with colonies

picked for colonies, incubated them at 37°C for 8 h

did a miniprep and send them for sequencing

---

26.09.2019

got the sequencing results → cloning worked

did a transformation of the plasmid with the right sequence and plated it 

---

27.09.2019

inoculated a colony form the new transformation in 20 mL LB + Chloramp., incubated at 30°C o/n

---

28.09.2019

- added 19 ml to 1 L LB + Chloramp. and induced with 0.2% arabinose when the culture had OD₆₀₀ 0.5

- added 1 ml to 20 mL LB + Chloramp. uninduced as negative control

- incubated both at 18°C o/n (21 h)

---

29.09.2019

- pelleted cells from both cultures at 16,000 rpm for 10 min at 4°C, discarded supernatant and stored at -80°C

- OD₆₀₀ 3.9 uninduced culture, OD₆₀₀ 3.1 induced culture

- took 32.3 μL of both cultures (with OD₆₀₀ 3.1) and pelleted cells, discarded supernatant and added 10 μL 5x Lämmli buffer, denatured at 96°C for 15 min

- ran SDS-Gel at 100 V

- stained with coomassie blue

loading plan: ladder, 8μL unind, 8μL ind, 2μL unind, 2 μL ind,

 

---

30.09.2019

- ran a new gel with different pellet concentration

- loading plan: ladder, 32ul unind, 32ul ind, 100 ul unind, 100 ul ind, 300 ul unind, 300 ul ind

 

inoculated new 4 mL cultures in TB, LB and M9 minimal medium, incubated at 37°C o/n

---

01.10.2019

- diluted cultures to OD₆₀₀ 0.1, let grow at 37°C until OD₆₀₀ 0.5 induced half of each medium with 0.2% Arabinose. Let shake for 3 h 30 min at 37°C, 200 rpm.

- ran a SDS gel at 100 V for 1 h 30 min 
 

loading plan: ladder, ladder, LB uninduced, LB induced, M9 uninduced, M9 induced, TB uninduced, TB induced

---

02.10.2019

- inoculated new 100 mL cultures in LB + Chloramp

---

03.10.2019

- diluted cultures to OD₆₀₀ 0.1 in L LB + Chloramp, let grow at 37°C until OD₆₀₀ 0.5 induced with 0.1% Arabinose. Let shake for 3 h at 37°C, 200 rpm.

- pelleted cells at 4,000 g, 10 min. Stored at -20°C

- cast a 12 % SDS gel

- ran the SDS gel, coomassie stained gel→ didn't work

---

04.10.2019

- resuspended cell pellet in 2 ml lysisbuffer per 0.8 gram, incubated 30 min on ice

- sonicated for 5 min, 30 s intervals 

- centrifuged at 4,000 g for 15 min, transferred supernatant to a new falcon. Stored at -20°C, discarded pellet. 

- purified the protein via his tag purification

→ to low concentration

 

- inoculated new 4 mL cultures in LB + Chloramp. incubated at 37°C o/n

---

05.10.2019

- diluted cultures to OD₆₀₀ 0.1, let grow at 37°C until OD₆₀₀ 0.5 induced with 0.1% and 0.2% Arabinose. Let shake at 37°C for 3 h and 6 h and at 18°C for o/n.

- pelleted cells at 4,000 g for 10 min

- ran a SDS gel

- blocked gel with 5% milk o/n

--> picture

---

06.10.2019

 

- ran SDS gel for westernblot

- blottet gel onto membrane

- blocked with 5% milk o/n at 4°C

---

07.10.2019

- washed membrane 3 times with 0.1% TBST

- incubated membrane with  His-antibody for 4 h at 4°C.

- washed membrane 3 times with 0.1% TBST

- incubated with secondary anti-mouse antibody for 1 h at 4°C.

loadingplan: 0.1% 3h 6h 9h ladder 0.2% arabinose 3h 6h 9h 

 

 

---

08.10.2019

- inoculated new 4 mL cultures in LB + Chloramp. incubated at 37°C o/n

---

09.10.2019

- diluted cultures to OD₆₀₀ 0.1, let grow at 37°C until OD₆₀₀ 0.5 induced with 0.1% and 0.2% Arabinose. Let shake at 37°C for 3 h and at 30°C o/n.

---

10.10.2019

- pelleted cells at 16,000 rpm

- added 1 mL lysis buffer and incubated for 30 min on ice

- sonicated cells for 5 x 30 s on ice

- pelleted cells again at 21,000 rpm, transferred supernatant to a fresh tube and resuspended pellet again in 1 mL lysis buffer. Stored at -20°C.

 

- ran SDS gel 

-stained with instant blue

- inoculated new culture, incubated 37°C o/n

---

11.10.2019

- o/n culture didn't grow due to additional Kanamycin in the medium

- inoculated a new culture in 100 mL LB + Chloramp., incubated o/n

---

12.10.2019

- diluted cultures to OD₆₀₀ 0.1 in 1 L culture, let grow at 37°C until OD₆₀₀ 0.5 induced with 0.5% Arabinose. Let shake at 37°C for 3 h.

- pelleted cells at 4.000 g for 15 min. Discarded supernatant. Stored pellet at -20°C.

---

13.10.2019

- washed cells with PBS

- added 5 mL lyses buffer and sonicated for 20 min 5x 30 s on ice

- purified racemase via his-tag purification

--> Added 0.5 g of resin to the column. Added 1 mL lysis buffer and incubated for 10 min.

      - Added 5 mL lysate and incubated for 5 min.

- let flow through gravitation.

- washed twice with 5 mL wash buffer. Let flow through gravitation.

- eluted 3 times with 1 mL elution buffer. Let flow through gravitation.

 

- took samples after each step and denaturated at 96°C for 10 min

- run a SDS gel

- stained with instant blue