Team:SEU/Experiments
Experiments
To demonstrate our calculations simulated by computer, we carried out following experiments. We will show these experiments in chronological order and present the whole process of our trial and error and improvements in experimental method.
All the experiments can be categorized into six parts:
a. Acquire single chain DNA sequences used in wet experiments (we got these sequences by our Software Tool).
b. Synthesize DNA in part 1 (in fact we bought them from Sangon Biotech).
c. Dissolve, dilute, mix.
d. Denature and anneal (acquire the results of fluorescence intensity by qRT-PCR simultaneously).
e. Purify and quantify the reactant complexes.
f. Characterization via PAGE
| 1ai | ACACCATCCATCCACACCATACTACCTCTCTCCACCATAC | 40 | ||
| 1Gia | ACTACCTCTCTCCACCATACACCACACCACCACACACCATACCTCACCACTCCACACTCT | 60 | 3`6-FAM | |
| 1Gib | TGGTATGATGGAGAGAGGTGGTATG | 25 | ||
| 1Tia | ACCACACCACCACACACCATACTCTCTCCTTCCACCATAC | 40 | ||
| 1Tib | ACCTCACCACTCCACACTCTACCTCCACAACCAACTCTAC | 40 | ||
| 1Tic | TGGTATGGTGTGGTGGTGTGTGGTATGGAGTGGTGAGGTGTGAGA | 45 | 5`BHQ1 | |
| 2ai | ACACCATCCATCCACACTCAACTACCTCTCTCCACTCAAC | 40 | ||
| 2Lia1 | ACTACCTCTCTCCACTCAACACATC | 25 |
Basic experiment details are as follows:
1. Dissolve, dilute, mix
All the single chain DNAs were dissolved in DEPC-treated water to form 100 uM solutions respectively and saved at 4 ℃.
Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM Mg2+(1×TAE/Mg2+) and saved at 4 ℃ for further experiments.
2. Gel electrophoresis
To examine the products of every kinetics experiments and purify the reactant complexes, 12% non-denaturing PAGE was run at 40 V for about 3.5 hours. After staining with GelRed (Biotium, 1:10000) for 30 min, the gel was scanned on a gel imaging system (Tanon 3500R).
Formulation for 12% native PAGE is as follows:
| 29:1 30% Acrylamide/bis | Deionized Water | 5xTBE Buffer | 10% APS | TEMED | Total Volume |
| 4mL | 3.93mL | 2mL | 0.07mL | 0.007mL | 10mL |
3. Reactant complexes purification and quantification
After acquiring the reactant complexes, we used them to carry out the polyacrylamide gel electrophoresis and obtained the target stripes cut down from the gel with the assistance of a gel imaging system (Tanon 3500R).
4. Kinetics experiments
Denaturing and annealing were performed in a quantitative real-time PCR (qRT-PCR) machine, first heating up to 95 oC, then slowly cooling down to 25 ℃ at the rate of 1 ℃/min, and finally holding at 20 ℃ for 2－4 hours.
For the same sample, we tried two concentrations of reactants, that is, 1 uM and 0.1 uM. For each concentration, we used three reaction cups to carry out the experiments, 20 uL in each cup.
Reactant complexes were synthesized with the reactant amount at 20 uM.
Experiment process are as follows:
1. Synthesis of reactant complexes
Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM Mg2+(1×TAE/Mg2+) and saved at 4 ℃ for further experiments. Volumes for all the reaction system here at one time are all 50 uL. The concrete details are shown in table (XX).
| 1Gi (Reactant Complex for Addition) | |
| 1Gia (100 uM) | 10uL |
| 1Gib (100 uM) | 10uL |
| Deionized Water | 25uL |
| 10×TAE Buffer | 5uL |
| 1Ti (Reactant Complex for Addition) | |
| 1Tia (100 uM) | 10uL |
| 1Tib (100 uM) | 10uL |
| 1Tic (100 uM) | 10uL |
| Deionized Water | 15uL |
| 10×TAE Buffer | 5uL |
| 2Li (Reactant Complex for Addition) | |
| 2Lia1 (100 uM) | 10uL |
| 2Lia2 (100 uM) | 10uL |
| 2Lib (100 uM) | 10uL |
| Deionized Water | 15uL |
| 10×TAE Buffer | 5uL |
| 2Ti (Reactant Complex for Addition) | |
| 1Tia (100 uM) | 10uL |
| 1Tib (100 uM) | 10uL |
| Deionized Water | 25uL |
| 10×TAE Buffer | 5uL |
| 3Li (Reactant Complex for Addition) | |
| 3Lia1 (100 uM) | 10uL |
| 3Lia2 (100 uM) | 10uL |
| 3Lib (100 uM) | 10uL |
| Deionized Water | 15uL |
| 10×TAE Buffer | 5uL |
| 3Ti (Reactant Complex for Addition) | |
| 3Tic (100 uM) | 10uL |
| 3Tid (100 uM) | 10uL |
| 3a (100 uM) | 10uL |
| 3b (100 uM) | 10uL |
| Deionized Water | 5uL |
| 10×TAE Buffer | 5uL |
| 3Wi (Reactant Complex for Addition) | |
| 3WiUp (100 uM) | 10uL |
| 3WiDown (100 uM) | 10uL |
| Deionized Water | 25uL |
| 10×TAE Buffer | 5uL |
2. Kinetics experiments of addition
After we obtained the reactant complexes, we began to use these DNAs to study their kinetic feature. We carried out experiments one after another using different experimental conditions, including using reactant complexes before or after purification, one-step or multi-step and different types of quantitative real-time PCR (qRT-PCR) machine.
Firstly, we wanted to study whether denaturing and annealing step by step is more valid than just mixing and running in one time when testing a kind of calculation, so we kept other conditions unchanged, all using unrefined reactant complexes and the same PCR machine (BIO-RAD CFX96). Then we found there are not obvious difference between these two kinds of strategies.
However, it occurred that the results are somewhat odd in that the fluorescence intensities of some circles are negative despite that we repeated these experiments for several times, which means that something must be wrong with the experiments. And, although with some strange points, the general tendency was right because we could see a sudden decrease of fluorescence intensity during annealing, which could not happen without our target single stranded DNAs combining and fluorophores encountering quenchers.
In order to demonstrate the conduct of the addition reaction, we used 12% native PAGE to visualize the DNA fragments. And we could observe the formation of Oi (the target product of the first step of two-step group) and the mixture of b and c (the target product of the whole experiment). It is because b and c share the same length XXXXXXXXXXXX
To reduce the interference of unreacted single stranded DNAs in reactant complexes, we conducted purification to the reactant complexes (1Gi and 1Ti in addition reaction) after above experiments.
As for the odd data points referred above, we tried three types of qRT-PCR machine, that is, BIO-RAD CFX96, Applied Biosystems QuantStudio 3 and Applied Biosystems StepOnePlus Real-Time PCR Systems. Results are shown as follows:
3. Kinetics experiments of subtraction
Just like what we did in addition reaction part, we also tried different strategies and different machines.
4. Kinetics experiments of multiplication
Different from addition and subtraction, there is a kind of short double-stranded DNA called exponential factor in multiplication reaction. How we utilize them is to change the concentration or ratio of them and to see whether it make a difference in the reaction system.