(19 intermediate revisions by the same user not shown) | |||
Line 75: | Line 75: | ||
<h2>Experiments</h2> | <h2>Experiments</h2> | ||
− | <p>To demonstrate our calculations simulated by computer, we carried out following experiments. We will show these experiments in chronological order and present the whole process of our | + | <p>To demonstrate our calculations simulated by computer, we carried out following experiments. We will show these experiments in chronological order and present the whole process of our trials , errors and improvements in experiments.</p> |
<h4>All the experiments can be categorized into six parts:</h4> | <h4>All the experiments can be categorized into six parts:</h4> | ||
<p>a. Acquire single chain DNA sequences used in wet experiments (we got these sequences by our <a href="https://2019.igem.org/Team:SEU/Software"><b>Software Tool</b></a>).<br> | <p>a. Acquire single chain DNA sequences used in wet experiments (we got these sequences by our <a href="https://2019.igem.org/Team:SEU/Software"><b>Software Tool</b></a>).<br> | ||
b. Synthesize DNA in part 1 (in fact we bought them from Sangon Biotech).<br> | b. Synthesize DNA in part 1 (in fact we bought them from Sangon Biotech).<br> | ||
c. Dissolve, dilute, mix.<br> | c. Dissolve, dilute, mix.<br> | ||
− | d. Denature and anneal | + | d. Denature and anneal and acquire the results of fluorescence intensity by qRT-PCR simultaneously.<br> |
e. Purify and quantify the reactant complexes.<br> | e. Purify and quantify the reactant complexes.<br> | ||
− | f. | + | f. Characterize via native PAGE</p> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<h4>Basic experiment details are as follows:</h4> | <h4>Basic experiment details are as follows:</h4> | ||
<h5>1. Dissolve, dilute, mix</h5> | <h5>1. Dissolve, dilute, mix</h5> | ||
<p>All the single chain DNAs were dissolved in DEPC-treated water to form 100 uM solutions respectively and saved at 4 ℃.<br> | <p>All the single chain DNAs were dissolved in DEPC-treated water to form 100 uM solutions respectively and saved at 4 ℃.<br> | ||
− | Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM | + | Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM Mg\(^{2+}\) (1×TAE/Mg\(^{2+}\)) and saved at 4 ℃ for later experiments.</p> |
<h5>2. Gel electrophoresis</h5> | <h5>2. Gel electrophoresis</h5> | ||
− | <p>To examine the products of every kinetics experiments and purify the reactant complexes, 12% non-denaturing PAGE was run at 40 V for about 3.5 hours. After staining with GelRed (Biotium | + | <p>To examine the products of every kinetics experiments and purify the reactant complexes, 12% non-denaturing native PAGE was run at 40 V for about 3.5 hours. After staining with GelRed (Biotium) for 30 min, the gel was scanned on a gel imaging system (Tanon 3500R).<br> |
− | Formulation for 12% native PAGE is as follows: | + | Formulation for 12% native PAGE gel is as follows: |
</p> | </p> | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
− | <td>29:1 30% Acrylamide/ | + | <td>29:1 30% Acrylamide/Bis</td> |
<td>Deionized Water</td> | <td>Deionized Water</td> | ||
<td>5xTBE Buffer</td> | <td>5xTBE Buffer</td> | ||
Line 273: | Line 111: | ||
</tr> | </tr> | ||
</table> | </table> | ||
− | <p>We | + | <p>We used both double stranded DNA (dsDNA) ladder marker and single stranded DNA (ssDNA) ladder marker in gel electrophoresis. All the reactants were also utilized to help localize the targeted stripes. |
+ | <!-- as markers because DNAs in our reaction systems included both ssDNA and dsDNA, especially with long sticky ends or cohesive ends, which were hard to recognize and analyse though mere dsDNA ladder marker and ssDNA ladder marker. --> | ||
+ | </p> | ||
<h5>3. Reactant complexes purification and quantification</h5> | <h5>3. Reactant complexes purification and quantification</h5> | ||
− | <p>After acquiring the reactant complexes, we used them to carry out the polyacrylamide gel electrophoresis and obtained the target stripes cut down from the gel with the assistance of a gel imaging system (Tanon 3500R). Gel fragments were broken up and suspended in TE buffer about the same volume as the fragments and kept in 37 | + | <p>After acquiring the reactant complexes, we used them to carry out the polyacrylamide gel electrophoresis and obtained the target stripes cut down from the gel with the assistance of a gel imaging system (Tanon 3500R). Gel fragments were broken up and suspended in TE buffer about the same volume as the fragments and kept in table concentrator (37 ℃) for 12 hours. Then we obtained the DNA solutions after centrifugation (15000 rpm, 5 min) and used another 0.5 time of volume of the as-mentioned DNA solutions to get the remaining DNAs by repeating the process of shaking and centrifuging. After that, ethanol (4 ℃) as much as two folds of the extraction solution was added in and then the mixtures were put on ice for 30 min. The mixtures were centrifuged at 15000 rpm for 20 min to get the DNA precipitate. Afterwards, firstly 200 uL TE buffer (pH 8.0) and then 25 uL 3 mol/L NaAc (pH 5.2) was added. After that, another 450 uL ethanol and 1 uL 20 mg/mL glycogen were added into the mixtures to re-precipitate the DNAs. After 12 hours, the mixtures were centrifuged at 15000 rpm for 20 min and washed with 70 % (V/V) ethanol, then we used 20 uL TE buffer (pH 8.0) to dissolve the precipitate to get the purified reactant complexes. UV—vis spectrophotometer (Nanodrop 2000, Thermofisher Scientific) was used to quantify the concentrations of DNAs of these products.</p> |
+ | <p>The concentrations of reactant complexes are calculated using the following equations:</p> | ||
+ | <center><p>Molecular weights of ssDNA: \(MW_{ssDNA}=\)amount of nucleotides\(\times 303.7+79.0\).<br> | ||
+ | Molecular weights of reactant complexes: \(MW_{rc}=\sum MW_{ssDNA}\)<br> | ||
+ | The mass concentration is translated to mol concentration using: \(c_{mol}=c_g/MW\)</p></center> | ||
<h5>4. Kinetics experiments</h5> | <h5>4. Kinetics experiments</h5> | ||
− | <p>Denaturing and annealing were performed in a quantitative real-time PCR (qRT-PCR) machine, first heating up to 95 | + | <p>Denaturing and annealing were performed in a quantitative real-time PCR (qRT-PCR) machine, first heating up to 95 ℃, then slowly cooling down to 20 ℃ at the rate of 1 ℃/min, and finally holding at 20 ℃ for 2-4 hours.<br> |
− | For the same sample, we tried two concentrations of reactants, that is, 1 uM and 0.1 uM. For each concentration, we used three reaction cups to carry out the experiments | + | For the same sample, we tried two concentrations of reactants, that is, 1 uM and 0.1 uM. For each concentration, we used three reaction cups with 20 uL in each to carry out the experiments.<br> |
− | Reactant complexes were synthesized with the | + | Reactant complexes were synthesized with the expected concentration of 20 uM.</p> |
<h4>Experiment process are as follows:</h4> | <h4>Experiment process are as follows:</h4> | ||
<h5>1. Synthesis of reactant complexes</h5> | <h5>1. Synthesis of reactant complexes</h5> | ||
− | <p>Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM | + | <p>Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM Mg\(^{2+}\)(1×TAE/Mg\(^{2+}\)) and saved at 4 ℃ for later experiments. Volumes for all the reaction system here at one time are all 50 uL. The details are shown in the following table.</p> |
− | + | <center> | |
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
Line 334: | Line 178: | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
− | <td colspan="2">2Li (Reactant Complex for | + | <td colspan="2">2Li (Reactant Complex for Subtraction)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 360: | Line 204: | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
− | <td colspan="2">2Ti (Reactant Complex for | + | <td colspan="2">2Ti (Reactant Complex for Subtraction)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 384: | Line 228: | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
− | <td colspan="2">3Li (Reactant Complex for | + | <td colspan="2">3Li (Reactant Complex for Multiplication)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 410: | Line 254: | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
− | <td colspan="2">3Ti (Reactant Complex for | + | <td colspan="2">3Ti (Reactant Complex for Multiplication)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 440: | Line 284: | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
− | <td colspan="2">3Wi (Reactant Complex for | + | <td colspan="2">3Wi (Reactant Complex for Multiplication)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 459: | Line 303: | ||
</tr> | </tr> | ||
</table> | </table> | ||
− | + | </center> | |
+ | <p>The qRT-PCR curves of reactant complexes are as follows (results are obtained by the Biorad instrument): </p> | ||
+ | <center> | ||
+ | <img src="https://static.igem.org/mediawiki/2019/5/5d/T--SEU--reactant_complexes.png" width="620"> | ||
+ | </center> | ||
+ | <p>In fact, we could see the beginning and ending values of fluorophore-labeled reactant complexes are negative, which are confusing because fluorescence intensity can not smaller than zero if the measurement of fluorescence is correct. This will be explained and solved in the following parts.</p> | ||
<h5>2. Kinetics experiments of addition </h5> | <h5>2. Kinetics experiments of addition </h5> | ||
− | <p>After we obtained the reactant complexes, we began to use these DNAs to study their kinetic | + | <p>The diagram of DSD reactions that perform addition calculation is shown in the following figure. We assume that there are two outputs. The names of each single stranded DNA are labeled, and the positions of fluorophores and quenchers are shown. The corresponding sequences can be found in our Appendix.</p> |
− | Firstly, we wanted to study whether denaturing and annealing step by step is more valid than just mixing and running in one time when testing a kind of calculation, so we kept other conditions unchanged, all using unrefined reactant complexes and the same PCR machine (BIO-RAD CFX96). Then we found there are | + | <center> |
+ | <img src="https://static.igem.org/mediawiki/2019/c/cd/T--SEU--additionExp.png" width="620"> | ||
+ | </center> | ||
+ | |||
+ | <p>After we obtained the reactant complexes, we began to use these DNAs to study their kinetic features. We carried out experiments one after another using different experimental conditions, including using reactant complexes before or after purification, one-step or multi-step, and different types of quantitative real-time PCR (qRT-PCR) machine.<br> | ||
+ | Firstly, we wanted to study whether denaturing and annealing step by step is more valid than just mixing and running in one time when testing a kind of calculation, so we kept other conditions unchanged, all using unrefined reactant complexes and the same PCR machine (BIO-RAD CFX96). Then we found there are no obvious difference between these two kinds of strategies. The detailed compositions of every reaction system is shown in the table below. Every reaction system was designed to contain 70 uL and then divided into three reaction cups with 20 uL a cup.</p> | ||
+ | <center> | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
Line 476: | Line 331: | ||
<td></td> | <td></td> | ||
<td>0.7uL</td> | <td>0.7uL</td> | ||
− | <td>0. | + | <td>0.7uL <br>(here 1ai was <br>diluted into <br>10 uM with H2O)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 493: | Line 348: | ||
<td>10xTAE Buffer</td> | <td>10xTAE Buffer</td> | ||
<td></td> | <td></td> | ||
− | <td></td> | + | <td>6.3uL</td> |
− | <td></td> | + | <td>6.93uL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 508: | Line 363: | ||
<td>10uL</td> | <td>10uL</td> | ||
<td>0.7uL</td> | <td>0.7uL</td> | ||
− | <td>0. | + | <td>0.7uL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 555: | Line 410: | ||
</table> | </table> | ||
− | <p>However, it occurred that the results are somewhat odd in that the fluorescence intensities of some circles are negative despite that we repeated these experiments for several times, which means that something must be wrong with the | + | </center> |
− | In order to demonstrate the | + | <p>However, it occurred that the results are somewhat odd in that the fluorescence intensities of some circles are negative despite that we repeated these experiments for several times, which means that something must be wrong with the processes. And, although with some strange points, the general tendency was right because we could see a sudden decrease of fluorescence intensity during annealing, which could not happen without our target single stranded DNAs combining each other and fluorophores encountering quenchers.<br> |
+ | In order to demonstrate the reaction did happen, we used 12% native PAGE to visualize the DNA fragments. And we could observe the formation of Oi (the target product of the first step of two-step group) and the mixture of b and c (the target product of the whole experiment). It is because b and c share the same length.<br> | ||
To reduce the interference of unreacted single stranded DNAs in reactant complexes, we conducted purification to the reactant complexes (1Gi and 1Ti in addition reaction) after above experiments.<br> | To reduce the interference of unreacted single stranded DNAs in reactant complexes, we conducted purification to the reactant complexes (1Gi and 1Ti in addition reaction) after above experiments.<br> | ||
As for the odd data points referred above, we tried three types of qRT-PCR machine, that is, BIO-RAD CFX96, Applied Biosystems QuantStudio 3 and Applied Biosystems StepOnePlus Real-Time PCR Systems.</p> | As for the odd data points referred above, we tried three types of qRT-PCR machine, that is, BIO-RAD CFX96, Applied Biosystems QuantStudio 3 and Applied Biosystems StepOnePlus Real-Time PCR Systems.</p> | ||
<h5>3. Kinetics experiments of subtraction</h5> | <h5>3. Kinetics experiments of subtraction</h5> | ||
− | <p>Just like what we did in addition reaction part, we also tried different strategies and different | + | <p>The diagram of DSD reactions that perform subtraction calculation is shown in the following figure. The names of each single stranded DNA are labeled, and the position of fluorophores and quenchers are shown. The corresponding sequences are shown in our Appendix.</p> |
− | <p>The detailed compositions of every reaction system | + | <center> |
+ | <img src="https://static.igem.org/mediawiki/2019/0/0e/T--SEU--subtractionExp.png" width="620"> | ||
+ | </center> | ||
+ | |||
+ | <p>Just like what we did in addition reaction part, we also tried different strategies and different instruments. However, we only conducted the one-step strategy due to the results demonstrated in the addition reaction.</p> | ||
+ | <p>The detailed compositions of every reaction system is shown in the following table. Every reaction system was designed to contain 70 uL liquid and then divided into three reaction cups with 20 uL in each cup.</p> | ||
+ | <center> | ||
<table border="1"> | <table border="1"> | ||
<tr> | <tr> | ||
<td></td> | <td></td> | ||
<td></td> | <td></td> | ||
− | |||
<td>1uM</td> | <td>1uM</td> | ||
<td>0.1uM</td> | <td>0.1uM</td> | ||
Line 574: | Line 435: | ||
<td>2ai (100uM)</td> | <td>2ai (100uM)</td> | ||
<td>0.7uL</td> | <td>0.7uL</td> | ||
− | <td>0. | + | <td>0.7uL <br>(here 2ai was <br>diluted into <br>10 uM with H2O)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>2bi (100uM)</td> | <td>2bi (100uM)</td> | ||
<td>0.7uL</td> | <td>0.7uL</td> | ||
− | <td>0. | + | <td>0.7uL <br>(here 2bi was <br>diluted into <br>10 uM with H2O)</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 601: | Line 462: | ||
<td>60.97uL</td> | <td>60.97uL</td> | ||
</tr> | </tr> | ||
− | + | </table> | |
− | < | + | |
− | <p> | + | <h3>Appendix</h3> |
− | + | <p>The sequences of our DNA strands:</p> | |
+ | <center> | ||
+ | <table border="1"> | ||
+ | <tr> | ||
+ | <td>Name</td> | ||
+ | <td>Sequence</td> | ||
+ | <td>Length</td> | ||
+ | <td>5` fluorophore-label</td> | ||
+ | <td>3` fluorophore-label</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1ai</td> | ||
+ | <td>ACACCATCCATCCACACCAT<br>ACTACCTCTCTCCACCATAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1Gia</td> | ||
+ | <td>ACTACCTCTCTCCACCATAC<br>ACCACACCACCACACACCAT<br>ACCTCACCACTCCACACTCT</td> | ||
+ | <td>60</td> | ||
+ | <td></td> | ||
+ | <td>3`6-FAM</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1Gib</td> | ||
+ | <td>TGGTATGATGGAGAGAGGTG<br>GTATG</td> | ||
+ | <td>25</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1Tia</td> | ||
+ | <td>ACCACACCACCACACACCAT<br>ACTCTCTCCTTCCACCATAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1Tib</td> | ||
+ | <td>ACCTCACCACTCCACACTCT<br>ACCTCCACAACCAACTCTAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>1Tic</td> | ||
+ | <td>TGGTATGGTGTGGTGGTGTG<br>TGGTATGGAGTGGTGAGGTGTGAGA</td> | ||
+ | <td>45</td> | ||
+ | <td>5`BHQ1</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2ai</td> | ||
+ | <td>ACACCATCCATCCACACTCA<br>ACTACCTCTCTCCACTCAAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2Lia1</td> | ||
+ | <td>ACTACCTCTCTCCACTCAAC<br>ACATC</td> | ||
+ | <td>25</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2Lia2</td> | ||
+ | <td>ACTCTCTCCTTCCACATCAC<br>ACCTCACCACTCCACACTCA</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td>3`6-FAM</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2Lib</td> | ||
+ | <td>TGAGTTGATGGAGAGAGGTG<br>AGTTGTGTAGTGAGAGAGGAAGGTGTAGTG</td> | ||
+ | <td>50</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2bi</td> | ||
+ | <td>ACCACACCACCACACACATC<br>ACTCTCTCCTTCCACATCAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2Tia</td> | ||
+ | <td>ACCTCACCACTCCACACTCA<br>ACCTCCACAACCAACTCAAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>2Tib</td> | ||
+ | <td>TAGTGTGGAGTGGTGAGGTG<br>TGAGT</td> | ||
+ | <td>25</td> | ||
+ | <td>5`BHQ1</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3ai</td> | ||
+ | <td>ACCTCCTCCTCCTACACAAC<br>ACCACCTCCTCCAACAACAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Lia1</td> | ||
+ | <td>ACCACCTCCTCCAACAACAC<br>ACTCT</td> | ||
+ | <td>25</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Lia2</td> | ||
+ | <td>ACACCTTCTTTACACTCTAC<br>ACCTCCTCCTCCTACACAAC<br>ACCTTTCCTCCTCACACTCT<br>ACCTCCTCACCTCACACTTC</td> | ||
+ | <td>80</td> | ||
+ | <td></td> | ||
+ | <td>3`6-FAM</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Lib</td> | ||
+ | <td>TGTTGTGGTGGAGGAGGTTG<br>TTGTGTGAGATGTGGAAGAA<br>ATGTGAGATG</td> | ||
+ | <td>50</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3b</td> | ||
+ | <td>ACCTTTCCTCCTCACACTCT<br>ACACCTTCTTTACACTCTAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Tic</td> | ||
+ | <td>ACCTCCTCACCTCACACTTC<br>ACACCTTCTTTACACTCTAC</td> | ||
+ | <td>40</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Tid</td> | ||
+ | <td>AGATGTGGAGGAGGAGGATG<br>TGTTGTGGAAAGGAGGAGTG<br>TGAGATGGAGGAGTGGAGTGTGAAG</td> | ||
+ | <td>65</td> | ||
+ | <td>5`BHQ1</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Wia</td> | ||
+ | <td>ACCACCTCCTCCAACAACAC</td> | ||
+ | <td>20</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>3Wib</td> | ||
+ | <td>GTGTTGTTGGAGGAGGTGGTGTTGT</td> | ||
+ | <td>25</td> | ||
+ | <td></td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | </table> | ||
+ | </center> | ||
+ | </center> | ||
</div> | </div> | ||
</div> | </div> |
Latest revision as of 14:12, 21 October 2019
![](https://static.igem.org/mediawiki/2019/b/be/T--SEU--tm-wy1.jpg)
Experiments
To demonstrate our calculations simulated by computer, we carried out following experiments. We will show these experiments in chronological order and present the whole process of our trials , errors and improvements in experiments.
All the experiments can be categorized into six parts:
a. Acquire single chain DNA sequences used in wet experiments (we got these sequences by our Software Tool).
b. Synthesize DNA in part 1 (in fact we bought them from Sangon Biotech).
c. Dissolve, dilute, mix.
d. Denature and anneal and acquire the results of fluorescence intensity by qRT-PCR simultaneously.
e. Purify and quantify the reactant complexes.
f. Characterize via native PAGE
Basic experiment details are as follows:
1. Dissolve, dilute, mix
All the single chain DNAs were dissolved in DEPC-treated water to form 100 uM solutions respectively and saved at 4 ℃.
Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM Mg\(^{2+}\) (1×TAE/Mg\(^{2+}\)) and saved at 4 ℃ for later experiments.
2. Gel electrophoresis
To examine the products of every kinetics experiments and purify the reactant complexes, 12% non-denaturing native PAGE was run at 40 V for about 3.5 hours. After staining with GelRed (Biotium) for 30 min, the gel was scanned on a gel imaging system (Tanon 3500R).
Formulation for 12% native PAGE gel is as follows:
29:1 30% Acrylamide/Bis | Deionized Water | 5xTBE Buffer | 10% APS | TEMED | Total Volume |
4mL | 3.93mL | 2mL | 0.07mL | 0.007mL | 10mL |
We used both double stranded DNA (dsDNA) ladder marker and single stranded DNA (ssDNA) ladder marker in gel electrophoresis. All the reactants were also utilized to help localize the targeted stripes.
3. Reactant complexes purification and quantification
After acquiring the reactant complexes, we used them to carry out the polyacrylamide gel electrophoresis and obtained the target stripes cut down from the gel with the assistance of a gel imaging system (Tanon 3500R). Gel fragments were broken up and suspended in TE buffer about the same volume as the fragments and kept in table concentrator (37 ℃) for 12 hours. Then we obtained the DNA solutions after centrifugation (15000 rpm, 5 min) and used another 0.5 time of volume of the as-mentioned DNA solutions to get the remaining DNAs by repeating the process of shaking and centrifuging. After that, ethanol (4 ℃) as much as two folds of the extraction solution was added in and then the mixtures were put on ice for 30 min. The mixtures were centrifuged at 15000 rpm for 20 min to get the DNA precipitate. Afterwards, firstly 200 uL TE buffer (pH 8.0) and then 25 uL 3 mol/L NaAc (pH 5.2) was added. After that, another 450 uL ethanol and 1 uL 20 mg/mL glycogen were added into the mixtures to re-precipitate the DNAs. After 12 hours, the mixtures were centrifuged at 15000 rpm for 20 min and washed with 70 % (V/V) ethanol, then we used 20 uL TE buffer (pH 8.0) to dissolve the precipitate to get the purified reactant complexes. UV—vis spectrophotometer (Nanodrop 2000, Thermofisher Scientific) was used to quantify the concentrations of DNAs of these products.
The concentrations of reactant complexes are calculated using the following equations:
Molecular weights of ssDNA: \(MW_{ssDNA}=\)amount of nucleotides\(\times 303.7+79.0\).
Molecular weights of reactant complexes: \(MW_{rc}=\sum MW_{ssDNA}\)
The mass concentration is translated to mol concentration using: \(c_{mol}=c_g/MW\)
4. Kinetics experiments
Denaturing and annealing were performed in a quantitative real-time PCR (qRT-PCR) machine, first heating up to 95 ℃, then slowly cooling down to 20 ℃ at the rate of 1 ℃/min, and finally holding at 20 ℃ for 2-4 hours.
For the same sample, we tried two concentrations of reactants, that is, 1 uM and 0.1 uM. For each concentration, we used three reaction cups with 20 uL in each to carry out the experiments.
Reactant complexes were synthesized with the expected concentration of 20 uM.
Experiment process are as follows:
1. Synthesis of reactant complexes
Reactant complexes were annealed together at 20 uM in Tris-acetate-EDTA buffer containing 12.5 mM Mg\(^{2+}\)(1×TAE/Mg\(^{2+}\)) and saved at 4 ℃ for later experiments. Volumes for all the reaction system here at one time are all 50 uL. The details are shown in the following table.
1Gi (Reactant Complex for Addition) | |
1Gia (100 uM) | 10uL |
1Gib (100 uM) | 10uL |
Deionized Water | 25uL |
10×TAE Buffer | 5uL |
1Ti (Reactant Complex for Addition) | |
1Tia (100 uM) | 10uL |
1Tib (100 uM) | 10uL |
1Tic (100 uM) | 10uL |
Deionized Water | 15uL |
10×TAE Buffer | 5uL |
2Li (Reactant Complex for Subtraction) | |
2Lia1 (100 uM) | 10uL |
2Lia2 (100 uM) | 10uL |
2Lib (100 uM) | 10uL |
Deionized Water | 15uL |
10×TAE Buffer | 5uL |
2Ti (Reactant Complex for Subtraction) | |
1Tia (100 uM) | 10uL |
1Tib (100 uM) | 10uL |
Deionized Water | 25uL |
10×TAE Buffer | 5uL |
3Li (Reactant Complex for Multiplication) | |
3Lia1 (100 uM) | 10uL |
3Lia2 (100 uM) | 10uL |
3Lib (100 uM) | 10uL |
Deionized Water | 15uL |
10×TAE Buffer | 5uL |
3Ti (Reactant Complex for Multiplication) | |
3Tic (100 uM) | 10uL |
3Tid (100 uM) | 10uL |
3a (100 uM) | 10uL |
3b (100 uM) | 10uL |
Deionized Water | 5uL |
10×TAE Buffer | 5uL |
3Wi (Reactant Complex for Multiplication) | |
3WiUp (100 uM) | 10uL |
3WiDown (100 uM) | 10uL |
Deionized Water | 25uL |
10×TAE Buffer | 5uL |
The qRT-PCR curves of reactant complexes are as follows (results are obtained by the Biorad instrument):
![](https://static.igem.org/mediawiki/2019/5/5d/T--SEU--reactant_complexes.png)
In fact, we could see the beginning and ending values of fluorophore-labeled reactant complexes are negative, which are confusing because fluorescence intensity can not smaller than zero if the measurement of fluorescence is correct. This will be explained and solved in the following parts.
2. Kinetics experiments of addition
The diagram of DSD reactions that perform addition calculation is shown in the following figure. We assume that there are two outputs. The names of each single stranded DNA are labeled, and the positions of fluorophores and quenchers are shown. The corresponding sequences can be found in our Appendix.
![](https://static.igem.org/mediawiki/2019/c/cd/T--SEU--additionExp.png)
After we obtained the reactant complexes, we began to use these DNAs to study their kinetic features. We carried out experiments one after another using different experimental conditions, including using reactant complexes before or after purification, one-step or multi-step, and different types of quantitative real-time PCR (qRT-PCR) machine.
Firstly, we wanted to study whether denaturing and annealing step by step is more valid than just mixing and running in one time when testing a kind of calculation, so we kept other conditions unchanged, all using unrefined reactant complexes and the same PCR machine (BIO-RAD CFX96). Then we found there are no obvious difference between these two kinds of strategies. The detailed compositions of every reaction system is shown in the table below. Every reaction system was designed to contain 70 uL and then divided into three reaction cups with 20 uL a cup.
10uM (Oi) | 1uM | 0.1uM | |||
One-Step | 1ai (100uM) | 0.7uL | 0.7uL (here 1ai was diluted into 10 uM with H2O) |
||
1Gi (20uM) | 3.5uL | 0.35uL | |||
1Ti (20uM) | 3.5uL | 0.35uL | |||
10xTAE Buffer | 6.3uL | 6.93uL | |||
Deionized Water | 56uL | 61.67uL | |||
Two-Step | The First Step of One-Step |
1ai (100uM) | 10uL | 0.7uL | 0.7uL |
1Gi (20uM) | 2uL | 3.5uL | 0.35uL | ||
10xTAE Buffer | 10uL | 6.65uL | 6.65uL | ||
Deionized Water | 7uL | 59.15uL | 62.3uL | ||
The Second Step of One Step |
Oi (10uM) | 7uL | 0.7uL | ||
1Ti (20uM) | 3.5uL | 0.35uL | |||
10xTAE Buffer | 5.95uL | 6.895uL | |||
Deionized Water | 53.55uL | 62.055uL |
However, it occurred that the results are somewhat odd in that the fluorescence intensities of some circles are negative despite that we repeated these experiments for several times, which means that something must be wrong with the processes. And, although with some strange points, the general tendency was right because we could see a sudden decrease of fluorescence intensity during annealing, which could not happen without our target single stranded DNAs combining each other and fluorophores encountering quenchers.
In order to demonstrate the reaction did happen, we used 12% native PAGE to visualize the DNA fragments. And we could observe the formation of Oi (the target product of the first step of two-step group) and the mixture of b and c (the target product of the whole experiment). It is because b and c share the same length.
To reduce the interference of unreacted single stranded DNAs in reactant complexes, we conducted purification to the reactant complexes (1Gi and 1Ti in addition reaction) after above experiments.
As for the odd data points referred above, we tried three types of qRT-PCR machine, that is, BIO-RAD CFX96, Applied Biosystems QuantStudio 3 and Applied Biosystems StepOnePlus Real-Time PCR Systems.
3. Kinetics experiments of subtraction
The diagram of DSD reactions that perform subtraction calculation is shown in the following figure. The names of each single stranded DNA are labeled, and the position of fluorophores and quenchers are shown. The corresponding sequences are shown in our Appendix.
![](https://static.igem.org/mediawiki/2019/0/0e/T--SEU--subtractionExp.png)
Just like what we did in addition reaction part, we also tried different strategies and different instruments. However, we only conducted the one-step strategy due to the results demonstrated in the addition reaction.
The detailed compositions of every reaction system is shown in the following table. Every reaction system was designed to contain 70 uL liquid and then divided into three reaction cups with 20 uL in each cup.
1uM | 0.1uM | ||
One-Step | 2ai (100uM) | 0.7uL | 0.7uL (here 2ai was diluted into 10 uM with H2O) |
2bi (100uM) | 0.7uL | 0.7uL (here 2bi was diluted into 10 uM with H2O) |
|
2Li (20uM) | 3.5uL | 0.35uL | |
2Ti (20uM) | 3.5uL | 0.35uL | |
10xTAE Buffer | 6.3uL | 6.93 | |
Deionized Water | 55.3uL | 60.97uL |
Appendix
The sequences of our DNA strands:
Name | Sequence | Length | 5` fluorophore-label | 3` fluorophore-label |
1ai | ACACCATCCATCCACACCAT ACTACCTCTCTCCACCATAC |
40 | ||
1Gia | ACTACCTCTCTCCACCATAC ACCACACCACCACACACCAT ACCTCACCACTCCACACTCT |
60 | 3`6-FAM | |
1Gib | TGGTATGATGGAGAGAGGTG GTATG |
25 | ||
1Tia | ACCACACCACCACACACCAT ACTCTCTCCTTCCACCATAC |
40 | ||
1Tib | ACCTCACCACTCCACACTCT ACCTCCACAACCAACTCTAC |
40 | ||
1Tic | TGGTATGGTGTGGTGGTGTG TGGTATGGAGTGGTGAGGTGTGAGA |
45 | 5`BHQ1 | |
2ai | ACACCATCCATCCACACTCA ACTACCTCTCTCCACTCAAC |
40 | ||
2Lia1 | ACTACCTCTCTCCACTCAAC ACATC |
25 | ||
2Lia2 | ACTCTCTCCTTCCACATCAC ACCTCACCACTCCACACTCA |
40 | 3`6-FAM | |
2Lib | TGAGTTGATGGAGAGAGGTG AGTTGTGTAGTGAGAGAGGAAGGTGTAGTG |
50 | ||
2bi | ACCACACCACCACACACATC ACTCTCTCCTTCCACATCAC |
40 | ||
2Tia | ACCTCACCACTCCACACTCA ACCTCCACAACCAACTCAAC |
40 | ||
2Tib | TAGTGTGGAGTGGTGAGGTG TGAGT |
25 | 5`BHQ1 | |
3ai | ACCTCCTCCTCCTACACAAC ACCACCTCCTCCAACAACAC |
40 | ||
3Lia1 | ACCACCTCCTCCAACAACAC ACTCT |
25 | ||
3Lia2 | ACACCTTCTTTACACTCTAC ACCTCCTCCTCCTACACAAC ACCTTTCCTCCTCACACTCT ACCTCCTCACCTCACACTTC |
80 | 3`6-FAM | |
3Lib | TGTTGTGGTGGAGGAGGTTG TTGTGTGAGATGTGGAAGAA ATGTGAGATG |
50 | ||
3b | ACCTTTCCTCCTCACACTCT ACACCTTCTTTACACTCTAC |
40 | ||
3Tic | ACCTCCTCACCTCACACTTC ACACCTTCTTTACACTCTAC |
40 | ||
3Tid | AGATGTGGAGGAGGAGGATG TGTTGTGGAAAGGAGGAGTG TGAGATGGAGGAGTGGAGTGTGAAG |
65 | 5`BHQ1 | |
3Wia | ACCACCTCCTCCAACAACAC | 20 | ||
3Wib | GTGTTGTTGGAGGAGGTGGTGTTGT | 25 |