Team:GO Paris-Saclay/NucleasesCharacterization/Pb
<!DOCTYPE html>
Creating pBAD24-MoClo
Project: Nucleases characterizations
Authors: iGEM_GO_Paris_saclay
Monday, 1/7/2019
Aim: create a Golden-Gate compatible pBAD24 plasmid using iGEM prefix & suffix for CDS
●
Coding sequences (CDS) cloned into pBAD24-MoClo will be under the transcriptional control of the arabinose-dependent promoter Para. Gene expression will be induced when bacteria harboring the pBAD24-CDS are grown in media containing arabinose. The expression will be repressed when bacteria are grown in media containing glucose (the catabolite repression is ensured by the binding of the CAP protein in the Para promoter of the plasmid).
●
Principle: amplify a DNA fragment with primers 2019GO-3-pBADMoClo-F and 2019GO-4-pBADMoClo-R using plasmid pBAD24GG as a template. Primer 2019GO-3 is phosphylated at the 5'-end. Thus the amplified fragment can be ligate to itself, creating pBAD24-MoClo.
pBAD24GG
A A | B B | C C | |
1 1 | Primer name | Primer sequence | Tm °C |
2 2 | 2019GO-3-pBADMoClo-F | 5’- Phosphate-AAAGGTCTCAGCTTGCGGATGAGAGAAG | 62 |
3 3 | 2019GO-4-pBADMoClo-R | 5’- AAAGGTCTCACATTGAATTCCTCCTGCTAG | 60 |
Primer sequences for creating pBAD24-MoClo
●
PCR amplification pBAD24GG : Hugues- Daniela- Natacha
Resuspend oligo 2019GO-3-pBADMoClo-F in 557 µL in milliQ water (it’s not at 100 pmol/µL, it’s at 56 pmol/µL)
Resuspend oligo 2019GO-4-pBADMoClo-R in 617 µL milliq water
Aliquots of oligos 2019GO-3 and 2019GO-4 were diluted at 1/10 in milliQ water
Dilution of 2µL pBAD24GG (empty plasmid vector used as template) in 18 µL of milliQ water
A A | B B | C C | |
1 1 | Components | Volume (μL) for 50 μL reaction | |
2 2 | Template DNA (pBAD24GG) | 1 | |
3 3 | Q5-High_Fidelity 2X Master Mix | 25 | |
4 4 | FW primer (2019GO-3-pBADMoClo-F) | 5 | |
5 5 | BW primer (2019GO-4-pBADMoClo-R) | 2,5 | |
6 6 | Nuclease free water | Up to 50 μL |
PCR master mix
Put the tubes in the PCR machine and apply the following program (it needs to be adjusted for primers annealing temperature and extension time):
A A | B B | C C | D D | |
1 1 | Step | Temperature (°C) | Time | Cycle |
2 2 | Initial denaturaration | 98 | 30s | 1 |
3 3 | Denaturaration | 98 | 10s | 30 |
4 4 | Annealing | 71 | 20s | / |
5 5 | Extension | 72 | 2 mn 15s | / |
6 6 | Final extension | 72 | 2 min | 1 |
PCR cycle settings
This PCR reaction did not work there were no expected fragments on the gel.
The Tm may have been too high, then this PCR was done again with a lower Tm.
Tuesday, 2/7/2019
Repeat PCR amplification from pBAD24GG : Hugues- Daniela- Natacha
The PCR was runned again in new agarose gels, 1% and 0.7%. There was still no results. Then, the PCR was done again the same manner.
Wednesday, 3/7/2019
PCR amplification from pBAD24GG : Hugues-Natacha-Clara
PCR reaction (from July the 1st) was prepared for loading on agarose gel : 1µL PCR in 6µL of bromophenol blue
Electrophoresis 30' 100V
It worked we got a signal at 4.5 kb. It's the correct size of the plasmid. See photo (indicated sizes for marker are in kb).
pcr.PNG
Nanodrop quantification of PCR product
Quantification of plasmid with the nanodrop: 495,657 ng/µL
Stock 10µL of PCR product at -20°C (BACK UP)
DpnI digestion
Add 0,5 µL of DpnI to the rest of plasmid (around 40µL)
Incubate at 37°C for 1 hour
20 minutes at 80°C
Stop on ice
PCR fragment clean up
See NucleoSpin Macherey-Nagel protocol
Nanodrop PCR fragment digested by DpnI
Quantification of plasmid linearized and digested by DpnI with the nanodrop: 97,421 ng/µL
Split up pBAD24GG into 2 samples (around 10µL in each)
Circularization of PCR fragment to create pBAD24-MoClo (empty vector)
Ligation;
Add 7µL of water into eppendorf
+2µL of ligase buffer (10X)
+1µL ligase (Promega)
+10µL PCR fragment
Incubate the mix at 4°C over night
pBAD24-MoClo
Transform DH5alpha with ligation product
The DH5alpha will provide a stock of circularized pBAD24-MoClo ready for Golden Gate cloning.