Team:BIT/Bio

Main Page

Overview

We constructed a microbial sensor which can determine environmental contaminants by detecting some biological indicators to evaluate the effects of DNA damage. Using biological indicators to assess the degree of DNA damage and its physiological effects is irreplaceable. We can also conduct an in-depth evaluation of individual health in this way.

Design

We use engineering bacteria to build our microbial sensors. Based on the principle that certain chemicals or radiation can cause DNA damage and then initiating the SOS response, we screened expression vectors, SOS response-inducible promoters and reporter genes to construct engineered bacteria, through the promoter’s response to certain chemicals to control the expression of reporter genes. We want to identify whether the chemicals being detected can damage DNA and describe the degree of DNA damage from the chemicals. The technical route is shown in the following figure.

This approach has three advantages:

  • 1.Easy and simple to handle. It can achieve that using the same bacterial strain to detect different kinds of reagents which can damage DNA, lowering the difficulty of detection;
  • 2.Detect quickly. It only takes two hours to detect once. And there is no large equipment required;
  • 3.The cultivation cost of engineering bacteria is low. The dose of reagents for detection is small. We use the 96-well plate which is suitable for high-throughput testing and conducive to automation.

After we successfully built the microbial sensor, it can detect different kinds of reagents those can cause DNA damage, such as anticancer agents, antibiotic drugs, alkylating agents and oxidation agents, and provides a fast, accurate quantitative analytical approach for evaluating the risks and hazards of known, unknown, and potentially toxic substances. In addition, we will optimize the performance of the microbial sensor in the future, expanding its detection range and improving its sensitivity.

At first, we used the SOS response-induced dinD and umuDC promoters to prove that DNA damaging agents do not affect protein expression efficiency, which will make the E. coli do not synthesize green fluorescent protein. So we can ensure that the gene line can normally produce fluorescence in E. coli when we use DNA reagents.

And then we used the SOS response-induced dnaK promoters to building our biosensor. One takes the dnaK promoter, the other takes the optimized GFP fluorescent protein gene, which is in the part BBa_E0240. We got some data.

The three gene lines are in the following.

Then we wanted to improve our project. So We have successfully constructed two plasmids through molecular cloning and synthetic biology methods. One takes the SOS response-induced RecA promoter, the other takes the optimized eGFP fluorescent protein gene. We transferred the constructed plasmid into the expression vector of E. coli BL21 (DE3), verified its function and found that it has a good response to DNA damage agents and correct expression of enhanced fluorescent protein. We can transfer the plasmid into different E. coli strains. The genetic circuit is shown below.

Figure (left) the sensor construction strategy based on recA promoter
Figure (right)the sensor principle based on SOS response

We used many kinds of DNA damage agents and other agents to induce the microbial sensor we have successfully constructed. See protocols for the detailed experimental procedures

Protocols

1.Obtain the strain

  • (1)Clone the recA promoter:

    • Use the TIANamp bacteria DNA kit (TianGen, DP302) to extract the genomic DNA of E.coli MG1655. The recA promoter fragment was cloned from the genome of E.coli MG1655 strain.

    Add the EcoRⅠ site to the sense primer :

    recA: 5’-AGGAgaattcCAGATGATCGGCGTACGCG-3’(there are four protective bases in the 5’ end);

    umuDC: 5’- GCGAATTCGTCACAATTTCGCGG -3’ ;

    dinD: 5’- GGAGAATTCCGCCCACTCAAAC -3’ ;

    dnaK: 5’- GCGAATTCCCCATCTAAACGTCTCC -3’ .

    Add the XbaⅠ site to the reverse primer :

    recA: 5’-CATGtctagaTTTTACTCCTGTCATGCCGGG-3’(there are four protective bases in the 5’ end);

    umuDC: 5’- GGATCTAGAATAGTTAGCCGGGC -3’ ;

    dinD: 5’-GCTCTAGATGTTCGTTCATTGCCC-3’;

    dnaK: 5’-GGCTCTAGAGCGCAAAAGCACAA-3’ .

    The PCR reaction system: 25μL 2×PCR Mastermix(TianGen), 2μL primers, 2μL genomic template, add ddH2O to 50μL.Reaction conditions: pre-denaturation at 94℃ for 3min, 30s at 94℃, annealing gradient at 52-62℃ for 30s, extension at 72℃ for 1min, extension at 72℃ for 5min after 30 cycles, and insulation at 10℃.

    Theoretically, the length of the amplified recA promoter fragment is about 390bp, and the RecA sequence was shown in appendixⅡ. Isolate the PCR products by agarose gel electrophoresis, the electrophoresis conditions: 1% agarose, 110V, 35min, 1×TAE electrophoresis buffer.

  • (2) Construct the plasmid:

    • After the amplification, recover the recA promoter which takes the EcoRⅠ site and XbaⅠ site and the pUC19-egfp.Then enzyme ligate them. The enzyme digestion system: 17 μL recovered fragment (puc19-egfp), 2 μL NEBuffer2.1, 0.5 μL EcoRI restriction enzyme (NEB), 0.5 μL XbaI restriction enzyme (NEB), mix them at 37℃ and digest for 3 hours.

    Perform agarose gel electrophoresis for separation (the condition is 1% agarose, 110V, 35min, 1×TAE electrophoresis buffer).Use the AxyPrep DNA gel recovery kit to recover DNA fragments.

    Glue the recovered target gene fragment and the puc19-egfp. In order to prevent self-ligation of the carrier, the amount of the carrier should be less than the amount of the target gene. Enzyme ligation system: 14 μL recA fragment, 3μL puc19-egfp, 2μL T4 DNA ligase buffer (10×), 1μL T4 DNA ligase, 16℃overnight.

  • (3) Transfer the production of the enzyme ligation and Screen the positive monoclonal antibody

    • Take 5μLBBa_E0240 and transfer it into E.coli Trans5α competent cells . Specific conditions are as following: transform the obtained BBa_E0240 plasmid to E. coli trans5 α, take the competent cells (TransGen Biotech) out of -80 ° c and put on ice, add 5mul puc19-egfp plasmid to the 50mul competent cells and mix them well, put the plasmid on the ice for 30 minutes, heat it for 90 seconds at 42 ° c, and then place it on ice for 2min.

    Take 5μL Puc19-recaegfp (hereinafter referred to as pre plasmid), the production of enzyme ligation, and transfer it into E.coli Trans5α and E.coli BL21 (DE3) competent cells under the same conditions above.

    Apply 100μL on LB plate which contains 100 μg/mL of ampicillin resistance, culture it upside down at 37℃ overnight, select the monoclonal colony, expand the culture, send it to jinweizhi (Suzhou) biochemisty co., ltd for sequencing, and store the remaining bacteria at -20℃ for reserve.

2.Induce the strain by damage agents

Culture the E.coli BL21 (DE3) strain and Trans5α strain transferred into the plasmid overnight at 37℃ in LB medium (AMP resistance), then inoculate in fresh LB liquid medium (AMP resistance). Shake the strain in a shaking table at 37℃ for 3 hours to logarithmic stage in which the range of OD600 is 0.2-0.4. Add DNA damage agents of different concentration gradients and induce them at 37℃130r/min for 2-3 hours.

Repeat each experiment three times to take the standard error.

3.Measure the data

Measure the fluorescence intensity and OD600: In sterile conditions, place 100μL solution in a 96-well black plate (Corning, USA). Set the fluorescence excitation wavelength to 480nm, the emission wavelength to 517nm, and gain to 75. Place 100μL solution in a 96-well transparent plate (Corning, USA) to measure the OD600. The two groups of data are scanned at room temperature by a multifunctional microplate reader (BioTek, USA).

4.Data analysis

OD600 represents the absorbance or optical density of the sample measured at the wavelength of 600nm.It is a common way to estimate the concentration of bacteria or other cells in a liquid.

Measuring concentrations can indicate the growth phase of a cell population, whether it is in the lag phase, the theexponential growth phase or the plateau phase.

Relative optical density ratio ROD=ODx/OD0 (1)

Formula(1) is the formula of relative optical density ratio. ODx is the absorption of the experimental group at the wavelength of 600nm. OD0 is the absorption of control group with no inducing agents in the medium at the same time. ROD reflects the toxicity of known or unknown compounds to the reca-egfp bacterial sensor.

specific fluorescence units SFU=RFU/OD60 (2)

Formula(2) is specific fluorescence. RFU is the unit of relative fluorescence determined by the enzyme reader. OD600 is the OD of the same sample, representing the fluorescence intensity of a unit of OD, and RFU reflects the fluorescence protein expression intensity of bacteria.This unit avoids the deviation of fluorescence intensity calculation caused by the difference of bacteria number between different samples.

Inducible factor Fi=SFUx/SFU0 (3)

Fi is calculated as SFUx/SFU0. SFUx is the sample treated with toxic compounds, and SFU0 is the control sample at the same time point. In this experiment, the ability of chemicals to damage DNA is evaluated by using the Fi. When the induction time is 2 hours and the Fi of the chemical reaches 2 or higher at any concentration, this chemical can be identified as DNA damage agent.

References

  • [1] Chen Z , Lu M , Zhuang G , et al. Enhanced Bacterial Biosensor for Fast and Sensitive Detection of Oxidatively DNA Damaging Agents[J]. Analytical Chemistry, 2011, 83(9):3248-3251.
  • [2] Nolte C , Matyash M , Pivneva T , et al. GFAP promoter controlled EGFP expressing transgenic mice: A tool to visualize astrocytes and astrogliosis in living brain tissue[J]. Glia, 2001, 33(1):72-86.
  • [3] Marinho H S , Real C , Luísa Cyrne, et al. Hydrogen peroxide sensing, signaling and regulation of transcription factors[J]. Redox Biol, 2014, 2(2):535562.
  • [4] Newmark KG, O’Reilly EK, Pohlhaus JR, Kreuzer KN. Genetic analysis of the requirements for SOS induction by nalidixic acid in Escherichia coli[J]. Gene, 2005, 356:69-76.
  • [5] Norman A, Hestbjerg Hansen L, Sørensen SJ: Construction of a ColD cda promoter-based SOS-green fluorescent protein whole-cell biosensor with higher sensitivity toward genotoxic compounds than constructs based on recA, umuDC, or sulA promoters.[J] Applied and Environmental Microbiology, 2005, 71:23382346.
  • [6] Nelson D L and Michael M C. Lehninger: Principles of Biochemistry. 4th Edition[M]. New York:W.H.Freeman and Company, 2005. p1098.
  • [7] Zhang A P P , Pigli Y Z , Rice P A . Structure of the LexA–DNA complex and implications for SOS box measurement[J]. NATURE, 2010, 466(7308):883886.
  • [8] Seaver L C , Imlay J A . Alkyl Hydroperoxide Reductase Is the Primary Scavenger of Endogenous Hydrogen Peroxide in Escherichia coli[J]. Journal of Bacteriology, 2001,183(24):7173-7181.
  • [9] Kostrzynska M, Leung K T, Lee H.Green fluorescent protein-based biosensor fordetecting SOS-inducing activity of genotoxic compounds[J]. Journal of Microbiological Methods.2002, 48:43-51.
  • [10] Simpson D M, Beynon R J. Acetone precipitation of proteins and the modification of peptides[J].Journal of Proteome Research, 2010, 9 (1):444-450